View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7246_high_31 (Length: 242)
Name: NF7246_high_31
Description: NF7246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7246_high_31 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 28030116 - 28030340
Alignment:
| Q |
18 |
caaataggacagtcagtgtttttgtcaccatcaaagcttttaaccggcggcaatgctcttattgcacacctagcaatctctgcaatcgtgccgaaagaca |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28030116 |
caaataggacaatcagtgtttttgtcaccatcaaagcttttaaccggcggcaatgctcttattgcacacctagcaatctctgcaatcgtgccgaaagaca |
28030215 |
T |
 |
| Q |
118 |
tattgatctgctgtaaatcaactatgtaatgtcccctttccctcatagaccatgcattatttctattttctctcatagacaatgcaatattattttgtgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28030216 |
tattgatctgctgtaaatcaactatgtaatgtcccctttccctcatagaccatgcattatttctattttccctcatagacaatgcaatattattttgtgc |
28030315 |
T |
 |
| Q |
218 |
aagagattcgaaaaattctctcctt |
242 |
Q |
| |
|
||||||||| ||||||||||||||| |
|
|
| T |
28030316 |
aagagattcaaaaaattctctcctt |
28030340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University