View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7246_high_32 (Length: 242)

Name: NF7246_high_32
Description: NF7246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7246_high_32
NF7246_high_32
[»] chr2 (2 HSPs)
chr2 (173-242)||(4446242-4446311)
chr2 (15-69)||(4446370-4446424)


Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 173 - 242
Target Start/End: Complemental strand, 4446311 - 4446242
Alignment:
173 tgttttctgctattgtttatcttaagcaacatgacacattttcaacaaacgttaaactataaataaactc 242  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4446311 tgttttctgctattgtttatcttaagcaacatgacacattttcaacaaacgttaaactataaataaactc 4446242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 15 - 69
Target Start/End: Complemental strand, 4446424 - 4446370
Alignment:
15 caatttttgcgaatacataaaacatgatccacgggatgccactgatccagcgcac 69  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||| ||||    
4446424 caatttttgcgaatacataaaacattatccacgggatgccactgatccagtgcac 4446370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University