View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7246_high_32 (Length: 242)
Name: NF7246_high_32
Description: NF7246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7246_high_32 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 173 - 242
Target Start/End: Complemental strand, 4446311 - 4446242
Alignment:
| Q |
173 |
tgttttctgctattgtttatcttaagcaacatgacacattttcaacaaacgttaaactataaataaactc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4446311 |
tgttttctgctattgtttatcttaagcaacatgacacattttcaacaaacgttaaactataaataaactc |
4446242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 15 - 69
Target Start/End: Complemental strand, 4446424 - 4446370
Alignment:
| Q |
15 |
caatttttgcgaatacataaaacatgatccacgggatgccactgatccagcgcac |
69 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
4446424 |
caatttttgcgaatacataaaacattatccacgggatgccactgatccagtgcac |
4446370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University