View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7246_low_25 (Length: 267)
Name: NF7246_low_25
Description: NF7246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7246_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 10 - 250
Target Start/End: Original strand, 14382174 - 14382422
Alignment:
| Q |
10 |
ctaagtgcatgtttcaaaagaattc-cagtgaaaattccaccatgaagcataaatatcannnnnnnnnnnnnnnaacatttcttaaatgtgtgtacagct |
108 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14382174 |
ctaagtgcatgtttcaaaagaaatcacagtgaaaattccaccatgaagcataaatatcatgtgtgtgtgtgtgtaacatttcttaaatgtgtgtacagct |
14382273 |
T |
 |
| Q |
109 |
taggaaacaaaatgaatgcatttagaattagtatacctgatatttcaaaggttctgaagagggttttggttttgcatccattagagagagggaagtg--- |
205 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14382274 |
taggaaacaaaatgaatgcatatagaattagtatacctgatatttcaaaggttctgaagagggttttggttttgcatccattagagagagggaagtggga |
14382373 |
T |
 |
| Q |
206 |
---gaattgaagagttgaaagcagagagtgaatgt-gggggcttaatga |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14382374 |
gtagaattgaagagttgaaagcagagagtgaatgtggggggcttaatga |
14382422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University