View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7246_low_25 (Length: 267)

Name: NF7246_low_25
Description: NF7246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7246_low_25
NF7246_low_25
[»] chr2 (1 HSPs)
chr2 (10-250)||(14382174-14382422)


Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 10 - 250
Target Start/End: Original strand, 14382174 - 14382422
Alignment:
10 ctaagtgcatgtttcaaaagaattc-cagtgaaaattccaccatgaagcataaatatcannnnnnnnnnnnnnnaacatttcttaaatgtgtgtacagct 108  Q
    |||||||||||||||||||||| || |||||||||||||||||||||||||||||||||               ||||||||||||||||||||||||||    
14382174 ctaagtgcatgtttcaaaagaaatcacagtgaaaattccaccatgaagcataaatatcatgtgtgtgtgtgtgtaacatttcttaaatgtgtgtacagct 14382273  T
109 taggaaacaaaatgaatgcatttagaattagtatacctgatatttcaaaggttctgaagagggttttggttttgcatccattagagagagggaagtg--- 205  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       
14382274 taggaaacaaaatgaatgcatatagaattagtatacctgatatttcaaaggttctgaagagggttttggttttgcatccattagagagagggaagtggga 14382373  T
206 ---gaattgaagagttgaaagcagagagtgaatgt-gggggcttaatga 250  Q
       |||||||||||||||||||||||||||||||| |||||||||||||    
14382374 gtagaattgaagagttgaaagcagagagtgaatgtggggggcttaatga 14382422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University