View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7246_low_30 (Length: 246)
Name: NF7246_low_30
Description: NF7246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7246_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 16 - 223
Target Start/End: Original strand, 2285633 - 2285840
Alignment:
| Q |
16 |
atgaagcatcaataaaacaaaggataaaagtgattaaaggaatgtattattcaataacttttatggtggcacgtacatgtgcacaagaagaaagaattaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2285633 |
atgaagcatcaataaaacaaaggataaaagtgattaaaggaatgtattattcaataacttttatggtggcacgtacatgtgcacaagaagaaagaattaa |
2285732 |
T |
|
| Q |
116 |
tatatctgttgctcctgattttggtgttattcctatacaaacattgtatacaagtagtggttgggatccaattgcttatggttttaaagctgaatatgat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2285733 |
tatatctgttgctcctgattttggtgttattcctatacaaacattgtatacaagtagtggttgggatccaattgcttatggttttaaagctgaatatgat |
2285832 |
T |
|
| Q |
216 |
gttgtgga |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
2285833 |
gttgtgga |
2285840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University