View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7246_low_9 (Length: 539)
Name: NF7246_low_9
Description: NF7246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7246_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 316; Significance: 1e-178; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 160 - 522
Target Start/End: Complemental strand, 32927623 - 32927249
Alignment:
| Q |
160 |
tgaattgaactaaagcagaccgtgaagccaaattgaattggacccaaagcagcaataagaacacaaaatagaaccgaaactgaatcccgcataaccgaag |
259 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32927623 |
tgaattgaactaaa-cagaccgtgaagccaaattgaattggacccaaagcagcaataagaacacaaaatagaaccgaaactgaatcccgcataacagaag |
32927525 |
T |
 |
| Q |
260 |
tagttgaacccataacactagattgtcttgaacccattttataccaactacccgtatgaagaaacggtttctgaagatcccttccatcaccactctcttc |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32927524 |
tagttgaacccataacactagattgtcttgaacccattttataccaactacccgtatgaagaaacggtttctgaagatcccttccatcaccactctcttc |
32927425 |
T |
 |
| Q |
360 |
tctgaaactcatcttcttaacccaaaaggtgtttgtgaaaatgtctcagagaagatttttggaacgtgatgttgctgagctgtgtaatagaagaagagtg |
459 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32927424 |
tctgaaactcatcttcttaacccaaaaggtgtttgtgaaaatgtctcagagaagatttttggaacgtgatgttgctgagctgtgtaatagaagaagagtg |
32927325 |
T |
 |
| Q |
460 |
agttaa-------------taattgtgaaaggttggtttcattgttgttcttatcatgtggtgttgcgtcaatgtg |
522 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32927324 |
agttaataataatggaaaataattgtgaaaggttggttacattgttgttcttatcatgtggtgttgcgtcaatgtg |
32927249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 12 - 83
Target Start/End: Complemental strand, 32927760 - 32927689
Alignment:
| Q |
12 |
aacctgtgaaacagagagcttgagatcattgattatagcttgttgcgtcggagaagaatatccacactttcc |
83 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32927760 |
aacctctgaaacagagagcttgagatcattgattatagcttgttgcgtcggagaagaatatccacactttcc |
32927689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University