View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7247_low_8 (Length: 206)
Name: NF7247_low_8
Description: NF7247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7247_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 40193275 - 40193084
Alignment:
| Q |
1 |
tgagcatatatatattctcagtagaagtagtattgctggctccaatgaaagaaaatacttatcagttatctcataggattagtttataatctaattgaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40193275 |
tgagcatatatatattctcagtagaagtagtattgctggctccaatgaaagaaaatacttatcagttatctcataggattagtttataatctaattgaca |
40193176 |
T |
 |
| Q |
101 |
atcgatttatcaaaaatttgtcaaaaataaatcgatttatcaaaaaagtgctaatattcatttagcttttagtaagactaaggacgtgatat |
192 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40193175 |
atcgatttatcaaaaatttgtcaaaaaaaaatcgatttatcaaaaaagtgctaatattcatttagcttttagtaagactaaggacgtgatat |
40193084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University