View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7248_low_3 (Length: 240)
Name: NF7248_low_3
Description: NF7248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7248_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 24 - 203
Target Start/End: Complemental strand, 26499575 - 26499396
Alignment:
| Q |
24 |
gtaaggaagattaagtgttttatttggttagtgctcctaatattgagattgtagtggtcaaaagctacttgaccagattttttgaggtttgaattatata |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26499575 |
gtaaggaagattaagtgttttatttggttaatggtcctaatattgagattgtagtggtcaaaagctacttgaccagattttttgaggtttgaattatata |
26499476 |
T |
 |
| Q |
124 |
atgagaaccaatcttggtcagggaacaagcaacaatttatagctttcactttgaaattgaatcaattttaaatttatgca |
203 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26499475 |
atgagaaccagtcttggtcagggaacaagcaacaatttatagctttcactttgaaattgaatcaattttaaatttatgca |
26499396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University