View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7249_high_4 (Length: 260)
Name: NF7249_high_4
Description: NF7249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7249_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 26 - 245
Target Start/End: Complemental strand, 37056197 - 37055974
Alignment:
| Q |
26 |
tatggtgttaggcaagtccaacaaaacatgaccccacagcagtccacatttacaattttttgattaaataacttttaactactaaaaagttttatgatcc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37056197 |
tatggtgttaggcaagtccaacaaaacatgaccccacagcagtccacatttacaattttttgattaaataacttttaactactaaaaagttttatgatcc |
37056098 |
T |
|
| Q |
126 |
a----acatcaaagatcatgtctcaattcccagatactaaaccttttgaatcatcatcaatcaaattataatgctaaaaagcaacaaggtgcatgttggt |
221 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37056097 |
atccaacatcaaagatcatgtctcaattcccagatactaaaccttttgaatcatcatcaatcaaattataatgctaaaaagcaacaaggtgcatgttggt |
37055998 |
T |
|
| Q |
222 |
agagtgttataataacatacttat |
245 |
Q |
| |
|
||||||||||||||| |||||||| |
|
|
| T |
37055997 |
agagtgttataataatatacttat |
37055974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University