View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7249_low_2 (Length: 386)
Name: NF7249_low_2
Description: NF7249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7249_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 311; Significance: 1e-175; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 43 - 369
Target Start/End: Original strand, 8002962 - 8003288
Alignment:
| Q |
43 |
gtcctgttccccagtaataacaagacacatgtcttttttaattaaaaattaaagaaatagtttatcttcttcattgatctgtctcaattgtttttacgca |
142 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8002962 |
gtcctgttccccaataataacaagacacatgtcttttttaattaaaaattaaagaaatagtttatcttcttcattgatctgtctcaattgtttttacgca |
8003061 |
T |
|
| Q |
143 |
gcaaagtcagtctcactttcttcttacctctttcacatggttcttcttggataaattggctatatccttcttttcagaattgtgatcgtcccatgtggcc |
242 |
Q |
| |
|
||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8003062 |
gcagagtcagtctcaatttcttcttacctctttcacatggttcttcttggataaattggctatatccttcttttcagaattgtgatcgtcccatgtggcc |
8003161 |
T |
|
| Q |
243 |
aaattaaatccttgaatccagtatcaatggcgacaactagcaaaggttgaatttccaccttcattccttccaacacgaactactattggcatcctcaact |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8003162 |
aaattaaatccttgaatccagtatcaatggcgacaactagcaaaggttgaacttccaccttcattccttccaacacgaactactattggcatcctcaact |
8003261 |
T |
|
| Q |
343 |
ctctcaccaactgccgtttccagtgaa |
369 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
8003262 |
ctctcaccaactgccgtttccagtgaa |
8003288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 240 - 317
Target Start/End: Complemental strand, 30517933 - 30517851
Alignment:
| Q |
240 |
gccaaattaaatcc-ttgaatccagtatcaatggc----gacaactagcaaaggttgaatttccaccttcattccttccaaca |
317 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||| ||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
30517933 |
gccaaattaaatcctttgaatccagggtcaatggcaacaaacaactagcaaaggttgaacttccaccttcattccttcaaaca |
30517851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 26 - 80
Target Start/End: Complemental strand, 30518163 - 30518109
Alignment:
| Q |
26 |
taccatatgtgctggtggtcctgttccccagtaataacaagacacatgtcttttt |
80 |
Q |
| |
|
|||| |||||||||||||| |||||||||| ||||||||| |||| |||| |||| |
|
|
| T |
30518163 |
taccttatgtgctggtggtactgttccccaataataacaatacacgtgtcctttt |
30518109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University