View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7250_low_6 (Length: 254)
Name: NF7250_low_6
Description: NF7250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7250_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 9063451 - 9063238
Alignment:
| Q |
1 |
gtggaaaaaataagtacaagaattgaaatgaagggtttttgtggcaaatccttcaacatggttgaaaattttgaaacttcaatttttgtgtgaccagacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9063451 |
gtggaaaaaataagtacaagaattgaaattaagggtttttgtgacaaatccttcaacatggttgaaaattttgaaacttcaatttttgtgtgacca---- |
9063356 |
T |
 |
| Q |
101 |
aatttagaaaaaatatgaatgttgcgtatgtgtgtaatgtaattgttttgcctatttattgagtagagaacaaggaaacttgggacagagctttaattga |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
9063355 |
-atttagaaaaaacatgaatgttgcgtatgtgtgtaatgtaattgttttgcctatttattgagtagagaacaaggaaacatgggatagagctttaattga |
9063257 |
T |
 |
| Q |
201 |
tgttacttaattagtataa |
219 |
Q |
| |
|
||||| ||||||||||||| |
|
|
| T |
9063256 |
tgttaattaattagtataa |
9063238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 213 - 241
Target Start/End: Complemental strand, 9063049 - 9063021
Alignment:
| Q |
213 |
agtataaactcaagatcaaggttattatt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9063049 |
agtataaactcaagatcaaggttattatt |
9063021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University