View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7250_low_7 (Length: 247)
Name: NF7250_low_7
Description: NF7250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7250_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 7410246 - 7410485
Alignment:
| Q |
1 |
ccttatctagatctctctcttcatatctctttacattttaattgtaaaataaaactatatatcggcgagttatgcatattaaaagctgtaaaaataggta |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7410246 |
ccttatctagatctctctcttcttatctctttacattttaattgtaaaataaaactatatatcggcgagttatgcatattaaaagctgtaaaaataggta |
7410345 |
T |
|
| Q |
101 |
ctaataattgtttatgcagaagaaactaattacgtctctctcatttgcacaactcacatgcaatttctacagctataggtgcagtaaagtgtcctgtgac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7410346 |
ctaataattgtttatgcagaagaaactaattatgtctctctcatttgcacaactcacatgcaatttctacagctataggtgcagtaaagtgtcctgtgac |
7410445 |
T |
|
| Q |
201 |
tggcattgtttattttaggaccactgtgtgtgcgtgtgtg |
240 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7410446 |
tggctttgtttattttaggaccactgtgtgtgtgtgtgtg |
7410485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University