View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7252_low_4 (Length: 292)
Name: NF7252_low_4
Description: NF7252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7252_low_4 |
 | |
|
| [»] scaffold0110 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0110 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 28113 - 28003
Alignment:
| Q |
1 |
tctcaccaattatttt-aaaagagattaatatatttttaaataaatgt-taaagtta----gnnnnnnnntgattcaattatgttatgttaaaatttact |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||| ||| | || |||||||||||| |||||||||||||| |
|
|
| T |
28113 |
tctcaccaattatttttaaaagagattaatatatttttaaataaatgtctaaatttagaaggaaaaaaaatgcttcaattatgttttgttaaaatttact |
28014 |
T |
|
| Q |
95 |
accacattact |
105 |
Q |
| |
|
||||||||||| |
|
|
| T |
28013 |
accacattact |
28003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University