View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7253_low_11 (Length: 251)
Name: NF7253_low_11
Description: NF7253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7253_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 235
Target Start/End: Complemental strand, 48961551 - 48961334
Alignment:
| Q |
18 |
gttcatgtatgcagccattggaattgaagattttgttcttcctttgttattcttatctttcttgtttatttttccttcatcagcacttgaactctcagat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48961551 |
gttcatgtatgcagccattggaattgaagattttgttcttcctttgttattcttatctttcttgtttatttttccttcatcagcacttgaactctcagat |
48961452 |
T |
 |
| Q |
118 |
tcaccaccatcaactttgattgtgttccccttcttgtgaagataattgggttggtgtttcttttgggattgaactagttccatataggctcctctgtttt |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48961451 |
tcaccaccgtcaactttgattgtgttccccttcttgtgaagataattgggttggtgtttcttttgggattgaactagttccatataggctcctctgtttt |
48961352 |
T |
 |
| Q |
218 |
cccctgcaattgttatca |
235 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
48961351 |
cccctgcaattgttatca |
48961334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University