View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7254_low_4 (Length: 240)
Name: NF7254_low_4
Description: NF7254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7254_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 43263880 - 43263989
Alignment:
| Q |
1 |
tcaaatattgttcataaaaggtatagctaggttattatagcagattccattaactttgatgtaaggttcttcacaattgagttcactgtgcaacaaatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43263880 |
tcaaatattgttcataaaaggtatagctaggttattatagcagattccattaactttgatgtaaggttcttcacaattgagttcactgtgcaacaaaata |
43263979 |
T |
 |
| Q |
101 |
ttgacacaga |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
43263980 |
ttgacacaga |
43263989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 143 - 225
Target Start/End: Original strand, 43264066 - 43264148
Alignment:
| Q |
143 |
tctgagctttttctaatgcaagtatcataacttgtgtaggagtgtgtttgttttaaggtctgtaaagttgtttttgagaatga |
225 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43264066 |
tctgagctttttctaatacaagtatcataacttgtgtaggagtgtgtttgttttaaggtctgtaaagttgtttttgagaatga |
43264148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University