View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7255_low_11 (Length: 218)
Name: NF7255_low_11
Description: NF7255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7255_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 16 - 183
Target Start/End: Complemental strand, 39557719 - 39557550
Alignment:
| Q |
16 |
aatatttcatactataggaagaagggtaggcggtgatggcaagaggatcaaaacattaatttaacgtacatatatatat--tcttagttttgatattgat |
113 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39557719 |
aatatttcatattataggaagaagggtaggcggtgatggcaagaggatcaaaacattaatttaacgtacatatatatatattcttagttttgatattgat |
39557620 |
T |
|
| Q |
114 |
gatttggatttggcatgataactactagaaaacatgtcattttcactataacagtgagaaatttgcatgc |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39557619 |
gatttggatttggcatgataactactagaaaacatgtcattttcactataacagtgagaaatttgcatgc |
39557550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University