View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7255_low_4 (Length: 414)
Name: NF7255_low_4
Description: NF7255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7255_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 15 - 397
Target Start/End: Complemental strand, 2116327 - 2115947
Alignment:
| Q |
15 |
ctgtgctacacatgcaagcagcctcatgtgtatgatatattttctatcattgtctagcattgcagaaaataatggttttggtcagattcaatcagacaca |
114 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2116327 |
ctgtgctacacatgcaagcagcctcttgtgtatgatatattttctatcattgtctagcattgcagaaaataatggttttggtcagattcaatcagacaca |
2116228 |
T |
 |
| Q |
115 |
ttattcaagtcttctgtttccttgcagcaaataatggtacctttgaaagacctatataccctaccctatgaatttatttttgacctacataaaaattaga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2116227 |
ttattcaagtcttctgtttccttgcagcaaataatggtacctttgaaagacctatataccctaccctatgaatttatttttgacctacataaaaattaga |
2116128 |
T |
 |
| Q |
215 |
ggaaattttcttttattaggtgtaaactagcggcgcattatgcatcaaccacttgcgctagacctagtaattcattagaggttattgctaattactaatt |
314 |
Q |
| |
|
|||| |||| ||||||||||||||||||| |||| ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2116127 |
ggaagtttttttttattaggtgtaaactaccggcacattatgcatcaaccacttgcaccagacctagtaattcattagaggttattgctaattactaatt |
2116028 |
T |
 |
| Q |
315 |
aaaagaaacagattttgcttagagcaatctttgaggaggttatcatgtgtacctatggtgagaactagttctaatccaaattc |
397 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
2116027 |
-aaagaaacagattttgcttaaagcgatctttgaggaggttatcatgtgtatctatggtgagaac-agttctaatccaaattc |
2115947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University