View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7255_low_9 (Length: 241)
Name: NF7255_low_9
Description: NF7255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7255_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 45 - 225
Target Start/End: Complemental strand, 49109586 - 49109406
Alignment:
| Q |
45 |
gttatttgcatgtaatttattatatggacaaattcataaagaaataatgaatgccagataaattaaagttatattatataattgcactgtgtttaagata |
144 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49109586 |
gttatttgcatgttatttattatatggacaaattcataaagaaataatgaatgccagataaattaaagttatattatataattgcactgtgtttaagata |
49109487 |
T |
 |
| Q |
145 |
aaataaataaataattagagacaaagtataggaaaaaggtattgatataatgcctgagcttttgagttttgggcataactg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49109486 |
aaataaataaataattagagacaaagtataggaaaaaggtattgatataatgcctgagtttttgagttttgggcataactg |
49109406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University