View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7256_low_14 (Length: 242)
Name: NF7256_low_14
Description: NF7256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7256_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 22945037 - 22944815
Alignment:
| Q |
1 |
atataatataaagaaccaacattactgggaggaatgaccttgaattccctagtagttgggttccacaatacaaatgttttatgatcaattccttggaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22945037 |
atataatataaagaaccaacattactgggaggaatgaccttgaattccctagtagttgggttccacaatacaaatgttttatgatcaattccttggaaga |
22944938 |
T |
 |
| Q |
101 |
gacaaatagttccattaatacaagaacccgaaatatcgatacatgtgtcatcatattgaaatggaagtggcaattctaatttcacttttgtctcaaacct |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22944937 |
gacaaatagttccattaatagaagaacccgaaatatcgatacatgtgtcatcatattgaaatggaagtggcaattctaatttcacttttgtctcaaacct |
22944838 |
T |
 |
| Q |
201 |
ctcgccagaaagcatataaactg |
223 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
22944837 |
ctcgccagaaaggatataaactg |
22944815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 26 - 65
Target Start/End: Original strand, 39721566 - 39721605
Alignment:
| Q |
26 |
tgggaggaatgaccttgaattccctagtagttgggttcca |
65 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39721566 |
tgggaggaatgaccttgaattcccgagtagttgggttcca |
39721605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 70
Target Start/End: Complemental strand, 42406263 - 42406217
Alignment:
| Q |
24 |
actgggaggaatgaccttgaattccctagtagttgggttccacaata |
70 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
42406263 |
actgggaggaatgaccttgaattcattggtagttgggttccacaata |
42406217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 25 - 70
Target Start/End: Complemental strand, 42777518 - 42777473
Alignment:
| Q |
25 |
ctgggaggaatgaccttgaattccctagtagttgggttccacaata |
70 |
Q |
| |
|
||||||||||||| ||||||||| |||||| |||||||||||||| |
|
|
| T |
42777518 |
ctgggaggaatgagcttgaattctttagtagatgggttccacaata |
42777473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 73
Target Start/End: Complemental strand, 41229045 - 41229001
Alignment:
| Q |
29 |
gaggaatgaccttgaattccctagtagttgggttccacaatacaa |
73 |
Q |
| |
|
||||||||||||| ||||| |||||| ||||||||||||||||| |
|
|
| T |
41229045 |
gaggaatgaccttaaattctatagtagatgggttccacaatacaa |
41229001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University