View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7256_low_15 (Length: 227)
Name: NF7256_low_15
Description: NF7256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7256_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 9 - 210
Target Start/End: Complemental strand, 50531029 - 50530828
Alignment:
| Q |
9 |
caccgcacacacgatgcagtatacatttgctttaagagtgagagtccattaaacgtacctgatgtcacaatttgtgacttctatatattcacatcacccc |
108 |
Q |
| |
|
|||| |||| |||||||| | ||| |||||||||| ||||||||||| ||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50531029 |
caccccacaaacgatgcaatttacgtttgctttaaaggtgagagtccactaaacatacctgatgtcacaatttgtaacttctatatattcacatcacccc |
50530930 |
T |
 |
| Q |
109 |
acaaatcatgtagtatatatttgctttagcggtgagagtccattaaatgtatttttaatctgatgtcataatttatgacttctatatttttaacattaaa |
208 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||| ||| |||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50530929 |
acaaatcatgtagtatacgtttgctttagcggtgagagtccactaaacttatatttagtctgatgtcatagtttatgacttctatatttttaacattaaa |
50530830 |
T |
 |
| Q |
209 |
at |
210 |
Q |
| |
|
|| |
|
|
| T |
50530829 |
at |
50530828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University