View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7256_low_16 (Length: 207)
Name: NF7256_low_16
Description: NF7256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7256_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 19 - 135
Target Start/End: Original strand, 33267346 - 33267462
Alignment:
| Q |
19 |
atggttcacactaaatattgatataaaactattttacataagatgtattatttagacaatcaaaaattgaaaattgtatccgacacaatatgaatacaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33267346 |
atggttcacactaaatattgatataaaactattttacataagatgtgttatttagacaatcaaaaattgaaaattgtatccgacacaatatgaatacaac |
33267445 |
T |
 |
| Q |
119 |
tagaatatgcgtgatgt |
135 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33267446 |
tagaatatgcgtgatgt |
33267462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University