View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7256_low_8 (Length: 354)
Name: NF7256_low_8
Description: NF7256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7256_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 87 - 347
Target Start/End: Original strand, 49405378 - 49405638
Alignment:
| Q |
87 |
catattcccctccattgtgctatacagaactaccagaggagtttcttgccaacaaaacttgttaaacagatatcatttttgggttttattaattgttcaa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49405378 |
catattcccctccattgtgctatacagaactaccagaggagtttcttgccaacaaaacttgttaaacagatatcatttttgggttttattaattgttcaa |
49405477 |
T |
 |
| Q |
187 |
aattactctaggctcaccgttttctaatagcttttctccaaaatgtaattgtctcttgtcttagaaaacgtttaatttcttcttttaacattgtttttaa |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49405478 |
aattactctaggctcaccgttttctaatagcttttgtccaaaatctaattgtctcttgtcttagaaaacgtttaatttcttcttttaacattgtttttaa |
49405577 |
T |
 |
| Q |
287 |
atgtaagactcttgtttattaaaaaatatggtataaattcttcaccaagtgattcatctca |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49405578 |
atgtaagactcttgtttattaaaaaatatggtataaattcttcaccaagtgattgatctca |
49405638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University