View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7257_high_15 (Length: 389)
Name: NF7257_high_15
Description: NF7257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7257_high_15 |
 |  |
|
| [»] scaffold0057 (2 HSPs) |
 |  |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold1176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 337; Significance: 0; HSPs: 25)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 1 - 370
Target Start/End: Original strand, 17471624 - 17471995
Alignment:
| Q |
1 |
atgacgagaccccttcccggaccctgcctatgcgggagttttagtgcaccggactacccctatgaaagtactttaactttctttcatcttttattattaa |
100 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17471624 |
atgatgagaccccttccctgaccctgcctatgcgggagttttagtgcaccggactacccctatgaaattactttaactttctttcatcttttattattaa |
17471723 |
T |
 |
| Q |
101 |
cagcata--ccatctataagtgcttaatacttacttggtaaagagcaagcaattcagaaatttgaaaggtgaatgaagcatagagaagctgaagcatgaa |
198 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
17471724 |
cagcatataccatctataagtgcttaatacttacttggtaaagagcaagcaattcagaaatttgaaaggtgaaggaagcatagagaagttgaagcatgaa |
17471823 |
T |
 |
| Q |
199 |
atcaacaactggccaacaaccaaagtgtaaacaatcatcatccacacaaacacaaacatctttagcagacaaatgatgatcctcaactctctcactatac |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17471824 |
atcaacaactggccaacaaccaaagtgtaaacaatcatcatccacacaaacacaaacatctttagcagacaaatgatgatcctcaactctctcactatac |
17471923 |
T |
 |
| Q |
299 |
aaataacgcagaacaacgttaagcgcttcaaacccaacatcataatccttagcaacttccttcagttgcagc |
370 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17471924 |
aaataacgcagaacaacgttaagcgcgtcaaacccaacatcataatccttagcaacttccttcagttgcagc |
17471995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 34080182 - 34080226
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34080182 |
gaccccttcccggaccctgcatatgcgggagttttagtgcaccgg |
34080226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 9671260 - 9671304
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
9671260 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
9671304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 10543781 - 10543825
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
10543781 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
10543825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 10546244 - 10546288
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
10546244 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
10546288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 14530401 - 14530445
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
14530401 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
14530445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 8 - 50
Target Start/End: Original strand, 14444809 - 14444851
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcacc |
50 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
14444809 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcacc |
14444851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 6 - 51
Target Start/End: Complemental strand, 3633764 - 3633719
Alignment:
| Q |
6 |
gagaccccttcccggaccctgcctatgcgggagttttagtgcaccg |
51 |
Q |
| |
|
||||||||||||||||||| || |||||||||| |||||||||||| |
|
|
| T |
3633764 |
gagaccccttcccggaccccgcatatgcgggagctttagtgcaccg |
3633719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 8455370 - 8455326
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
8455370 |
gaccccttcccggaccctgcgtatgccggagctttagtgcaccgg |
8455326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 21779315 - 21779271
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
21779315 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
21779271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 23488564 - 23488608
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||| ||| ||||||||||||| |
|
|
| T |
23488564 |
gaccccttcccggaccctgcgtatgcgagagctttagtgcaccgg |
23488608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 9 - 53
Target Start/End: Complemental strand, 24860041 - 24859997
Alignment:
| Q |
9 |
accccttcccggaccctgcctatgcgggagttttagtgcaccgga |
53 |
Q |
| |
|
|||||||| |||||||||| |||||||||| |||||||||||||| |
|
|
| T |
24860041 |
accccttctcggaccctgcgtatgcgggagctttagtgcaccgga |
24859997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 34766336 - 34766376
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgca |
48 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
34766336 |
gaccccttcccggaccctgcgtatgcgggagctttagtgca |
34766376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 40579803 - 40579759
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
40579803 |
gaccccttcccggaccctgagtatgcgggagctttagtgcaccgg |
40579759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 41409943 - 41409987
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| || |||||||||| |
|
|
| T |
41409943 |
gaccccttcccggaccctgcatatgcgggagcttcagtgcaccgg |
41409987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 5841111 - 5841154
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccg |
51 |
Q |
| |
|
||||||||||||||||| || |||||||||| |||||||||||| |
|
|
| T |
5841111 |
gaccccttcccggaccccgcatatgcgggagctttagtgcaccg |
5841154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 14 - 52
Target Start/End: Complemental strand, 124962 - 124924
Alignment:
| Q |
14 |
ttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
124962 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgg |
124924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 8 - 50
Target Start/End: Original strand, 8575976 - 8576018
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcacc |
50 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| ||||||||||| |
|
|
| T |
8575976 |
gaccccttcccggaccctgcgtatgtgggagctttagtgcacc |
8576018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 11 - 53
Target Start/End: Original strand, 11514519 - 11514561
Alignment:
| Q |
11 |
cccttcccggaccctgcctatgcgggagttttagtgcaccgga |
53 |
Q |
| |
|
|||||||| |||||||| |||||||||| |||||||||||||| |
|
|
| T |
11514519 |
cccttcccagaccctgcgtatgcgggagctttagtgcaccgga |
11514561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 8 - 50
Target Start/End: Original strand, 14544147 - 14544189
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcacc |
50 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| ||||||||||| |
|
|
| T |
14544147 |
gaccccttccgggaccctgcgtatgcgggagctttagtgcacc |
14544189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 14 - 52
Target Start/End: Original strand, 22371199 - 22371237
Alignment:
| Q |
14 |
ttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
22371199 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgg |
22371237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 24890492 - 24890533
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcac |
49 |
Q |
| |
|
|||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
24890492 |
gaccccttcccggaccctgcgtatgcaggagctttagtgcac |
24890533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 25079771 - 25079727
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| ||||||||||||| |
|
|
| T |
25079771 |
gaccccttcccggaccctgcgtatgcaagagctttagtgcaccgg |
25079727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 36871573 - 36871616
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
36871573 |
gaccccttcccggacc-tgcgtatgcgggagctttagtgcaccgg |
36871616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 44643604 - 44643648
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||| |
|
|
| T |
44643604 |
gaccccttcccagaccctgcgtatgcgggagccttagtgcaccgg |
44643648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 28)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 20284123 - 20284079
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20284123 |
gaccccttcccggaccctgcgtatgcgggagttttagtgcaccgg |
20284079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 21070751 - 21070707
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21070751 |
gaccccttcccggaccctgcgtatgcgggagttttagtgcaccgg |
21070707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 6 - 52
Target Start/End: Complemental strand, 39461050 - 39461004
Alignment:
| Q |
6 |
gagaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
39461050 |
gagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
39461004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 16013537 - 16013581
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
16013537 |
gaccccttcccagaccctgcctatgcgggagctttagtgcaccgg |
16013581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 7136581 - 7136537
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
7136581 |
gaccccttcccggaccccgcatatgcgggagctttagtgcaccgg |
7136537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 12625971 - 12626015
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||| ||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
12625971 |
gaccccctcccggaccctgcgtatgcgggagctttagtgcaccgg |
12626015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 12670304 - 12670260
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
12670304 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
12670260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 18595919 - 18595959
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgca |
48 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18595919 |
gaccccttcccggaccctgtgtatgcgggagttttagtgca |
18595959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 26102598 - 26102642
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
26102598 |
gaccccttcccggaccctgcttatgcgggagctctagtgcaccgg |
26102642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 27507991 - 27508035
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| ||||||||||||| |
|
|
| T |
27507991 |
gaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgg |
27508035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 28817680 - 28817640
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgca |
48 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
28817680 |
gaccccttcccggaccctgcgtatgcgggagctttagtgca |
28817640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 30454151 - 30454107
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
30454151 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
30454107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 35261760 - 35261804
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35261760 |
gaccccttcctggaccctgcgtatgcgggagctttagtgcaccgg |
35261804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 44530230 - 44530274
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
44530230 |
gaccccttcctggaccctgcgtatgcgggagctttagtgcaccgg |
44530274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 13 - 52
Target Start/End: Complemental strand, 27468141 - 27468102
Alignment:
| Q |
13 |
cttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
27468141 |
cttcccggaccctgcgtatgcgggagctttagtgcaccgg |
27468102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 8 - 50
Target Start/End: Complemental strand, 8897818 - 8897776
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcacc |
50 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||| |||||| |
|
|
| T |
8897818 |
gaccccttcccggaccctgcatatgcgggagctttactgcacc |
8897776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 14 - 52
Target Start/End: Complemental strand, 18164808 - 18164770
Alignment:
| Q |
14 |
ttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
18164808 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgg |
18164770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 8 - 50
Target Start/End: Original strand, 29877175 - 29877217
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcacc |
50 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
29877175 |
gaccccttcccggaccctgcgtatgcgggagcgttagtgcacc |
29877217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 8 - 50
Target Start/End: Original strand, 36720877 - 36720919
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcacc |
50 |
Q |
| |
|
|||||||||||||||||||| ||||||| || ||||||||||| |
|
|
| T |
36720877 |
gaccccttcccggaccctgcgtatgcggaagctttagtgcacc |
36720919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 11 - 52
Target Start/End: Original strand, 16225105 - 16225146
Alignment:
| Q |
11 |
cccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
16225105 |
cccttcccggaccccgcatatgcgggagctttagtgcaccgg |
16225146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 2677621 - 2677665
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||| |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
2677621 |
gaccccttctcggaccctgcgtatgcggatgttttagtgcaccgg |
2677665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 6760905 - 6760949
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||| ||||||| || |||||||||| ||||||||||||| |
|
|
| T |
6760905 |
gaccccttctcggaccccgcatatgcgggagctttagtgcaccgg |
6760949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 13160782 - 13160826
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| || ||||| |||| |
|
|
| T |
13160782 |
gaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgg |
13160826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 6 - 38
Target Start/End: Complemental strand, 20869556 - 20869524
Alignment:
| Q |
6 |
gagaccccttcccggaccctgcctatgcgggag |
38 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
20869556 |
gagaccccttcccggaccctgcatatgcgggag |
20869524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 20870006 - 20870050
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||| |||||| || |||||||||| ||||||||||||| |
|
|
| T |
20870006 |
gaccccttccaggaccccgcatatgcgggagctttagtgcaccgg |
20870050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 25250605 - 25250649
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||| |||| || |||||||||| ||||||||||||| |
|
|
| T |
25250605 |
gaccccttcccgaaccccgcatatgcgggagatttagtgcaccgg |
25250649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 28407484 - 28407528
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||| | |||||||||| |||| |||||||| |
|
|
| T |
28407484 |
gaccccttcccggaccctacgtatgcgggagctttactgcaccgg |
28407528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 45071345 - 45071389
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| || |||||||||| |
|
|
| T |
45071345 |
gaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgg |
45071389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 24)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 8 - 53
Target Start/End: Original strand, 25622541 - 25622586
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgga |
53 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
25622541 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgga |
25622586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 8170038 - 8169994
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
8170038 |
gaccccttcccggaccctgcatatgcgggagtttcagtgcaccgg |
8169994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 16957395 - 16957439
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
16957395 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
16957439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 38879664 - 38879708
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
38879664 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
38879708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 8 - 51
Target Start/End: Complemental strand, 12006382 - 12006339
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccg |
51 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
12006382 |
gaccccttcccagaccctgcctatgcgggagctttagtgcaccg |
12006339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 6 - 50
Target Start/End: Complemental strand, 7097816 - 7097772
Alignment:
| Q |
6 |
gagaccccttcccggaccctgcctatgcgggagttttagtgcacc |
50 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
7097816 |
gagaccccttcccgaaccctgcgtatgcgggagctttagtgcacc |
7097772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 59
Target Start/End: Original strand, 13774949 - 13774997
Alignment:
| Q |
11 |
cccttcccggaccctgcctatgcgggagttttagtgcaccggactaccc |
59 |
Q |
| |
|
||||| ||||||||||| |||||||||| ||||||||||||| |||||| |
|
|
| T |
13774949 |
ccctttccggaccctgcgtatgcgggagctttagtgcaccgggctaccc |
13774997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 16028678 - 16028634
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
16028678 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
16028634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 24448971 - 24449015
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
24448971 |
gaccccttcccggaccctgcgtatgcaggagctttagtgcaccgg |
24449015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 32703503 - 32703547
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
32703503 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
32703547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 43574687 - 43574731
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||| ||||||| |
|
|
| T |
43574687 |
gaccccttcccggaccctgcgtatgcgggagctttagagcaccgg |
43574731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 8 - 51
Target Start/End: Complemental strand, 21784386 - 21784343
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccg |
51 |
Q |
| |
|
|||||||| ||||||||||| |||||||||| |||||||||||| |
|
|
| T |
21784386 |
gacccctttccggaccctgcgtatgcgggaggtttagtgcaccg |
21784343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 49
Target Start/End: Complemental strand, 19142997 - 19142956
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcac |
49 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| |||||||||| |
|
|
| T |
19142997 |
gaccccttcccggaccatgcgtatgcgggagatttagtgcac |
19142956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 11 - 52
Target Start/End: Original strand, 32354211 - 32354252
Alignment:
| Q |
11 |
cccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
32354211 |
cccttcccggaccctgtgtatgcgggagctttagtgcaccgg |
32354252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 4619158 - 4619114
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||| || |||||| ||| ||||||||||||| |
|
|
| T |
4619158 |
gaccccttcccggaccccgcatatgcgagagctttagtgcaccgg |
4619114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 7368477 - 7368521
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| | ||||||||||| |
|
|
| T |
7368477 |
gaccccttcccggaccctgcatatgtgggagctctagtgcaccgg |
7368521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 10943898 - 10943855
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||||| | ||||||||| ||||||||||||| |
|
|
| T |
10943898 |
gaccccttcccggaccctg-caatgcgggagctttagtgcaccgg |
10943855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 13801821 - 13801777
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||| || |||||| ||| ||||||||||||| |
|
|
| T |
13801821 |
gaccccttcccggaccccgcatatgcgagagctttagtgcaccgg |
13801777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 16880701 - 16880657
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||| ||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
16880701 |
gaccacttcccggaccatgcgtatgcgggagctttagtgcaccgg |
16880657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 30877618 - 30877574
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| | ||||||||||| |
|
|
| T |
30877618 |
gaccccttcccggaccctgcatatgtgggagctctagtgcaccgg |
30877574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 34154868 - 34154824
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| ||||||| || | ||||||||||| |
|
|
| T |
34154868 |
gaccccttcccggaccctgcatatgcggtagctctagtgcaccgg |
34154824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 39801597 - 39801641
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||| |||||| | |||||||||| ||||||||||||| |
|
|
| T |
39801597 |
gaccccttcccagaccctacgtatgcgggagctttagtgcaccgg |
39801641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 41014399 - 41014443
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||| |||||| || |||||||||| ||||||||||||| |
|
|
| T |
41014399 |
gaccccttcctggaccccgcatatgcgggagctttagtgcaccgg |
41014443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 43334286 - 43334329
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||||| | ||||||||| ||||||||||||| |
|
|
| T |
43334286 |
gaccccttcccggaccctg-cgatgcgggagctttagtgcaccgg |
43334329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 28)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 8 - 53
Target Start/End: Original strand, 27474384 - 27474429
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgga |
53 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
27474384 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgga |
27474429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 4349742 - 4349786
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
4349742 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
4349786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 4587617 - 4587573
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
4587617 |
gaccccttcccggaccctgcctatgcgggagcttcagtgcaccgg |
4587573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 50606507 - 50606551
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
50606507 |
gaccccttcccggaccctgcatatgcgggagctttagtgcaccgg |
50606551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 11 - 52
Target Start/End: Original strand, 14617145 - 14617186
Alignment:
| Q |
11 |
cccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
14617145 |
cccttcccggaccctgcatatgcgggagctttagtgcaccgg |
14617186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 18944749 - 18944794
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggag-ttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
18944749 |
gaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgg |
18944794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 19701677 - 19701726
Alignment:
| Q |
10 |
ccccttcccggaccctgcctatgcgggagttttagtgcaccggactaccc |
59 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||| | |||||| |
|
|
| T |
19701677 |
ccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctaccc |
19701726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 6 - 55
Target Start/End: Complemental strand, 25554798 - 25554749
Alignment:
| Q |
6 |
gagaccccttcccggaccctgcctatgcgggagttttagtgcaccggact |
55 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
25554798 |
gagaccccttcccgaaccctgcgtatgcgggagcattagtgcaccggact |
25554749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 8 - 53
Target Start/End: Complemental strand, 35253241 - 35253196
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgga |
53 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | |||||||||||| |
|
|
| T |
35253241 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgga |
35253196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 8 - 53
Target Start/End: Complemental strand, 42304261 - 42304216
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgga |
53 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
42304261 |
gaccccttcccggaccctgcgtatgtgggagctttagtgcaccgga |
42304216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 10668331 - 10668375
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||| |||||| |||||||||| ||||||||||||| |
|
|
| T |
10668331 |
gaccccttcccggtccctgcgtatgcgggagctttagtgcaccgg |
10668375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 34725152 - 34725108
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
34725152 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
34725108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 35005229 - 35005273
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||| | ||||||||||||| |
|
|
| T |
35005229 |
gaccccttcccggaccctgcgtatgcgggcgctttagtgcaccgg |
35005273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 45402200 - 45402244
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||| |
|
|
| T |
45402200 |
gaccccttcccagaccctgcgtatgcgggagctttagtgcaccgg |
45402244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 46248007 - 46247963
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||| ||||| |
|
|
| T |
46248007 |
gaccccttcccggaccctgcgtatgcgggagctttagtgtaccgg |
46247963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 46991908 - 46991952
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| ||||||||||||| |
|
|
| T |
46991908 |
gaccccttcccggaccctgcgtatgtgggagctttagtgcaccgg |
46991952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 6925204 - 6925247
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccg |
51 |
Q |
| |
|
||||||||||||| |||||| |||||||||| |||||||||||| |
|
|
| T |
6925204 |
gaccccttcccggtccctgcgtatgcgggagctttagtgcaccg |
6925247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 8 - 51
Target Start/End: Complemental strand, 30395780 - 30395737
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccg |
51 |
Q |
| |
|
||||||||||||||||| || |||||||||| |||||||||||| |
|
|
| T |
30395780 |
gaccccttcccggaccccgcatatgcgggagctttagtgcaccg |
30395737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 8 - 59
Target Start/End: Complemental strand, 33594185 - 33594134
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccggactaccc |
59 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||| || |||||| |
|
|
| T |
33594185 |
gaccccttcccagaccctgcgtatgcgggagctttagtgcactgggctaccc |
33594134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 9939570 - 9939612
Alignment:
| Q |
10 |
ccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||| |||||||||| |||||||||| ||||||||||||| |
|
|
| T |
9939570 |
ccccttctcggaccctgcgtatgcgggagctttagtgcaccgg |
9939612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 6 - 52
Target Start/End: Original strand, 23796567 - 23796613
Alignment:
| Q |
6 |
gagaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||| |||||||| ||||| |||| ||||||||||||| |
|
|
| T |
23796567 |
gagaccccttcccagaccctgcatatgctggagctttagtgcaccgg |
23796613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 49
Target Start/End: Complemental strand, 12126891 - 12126850
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcac |
49 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | |||||||| |
|
|
| T |
12126891 |
gaccccttcccggaccctgcatatgcgggagctgtagtgcac |
12126850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 10378789 - 10378745
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
10378789 |
gaccccttcttggaccctgcatatgcgggagctttagtgcaccgg |
10378745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 18742011 - 18741967
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||| |||||||| |||||| ||| ||||||||||||| |
|
|
| T |
18742011 |
gaccccttcccagaccctgcgtatgcgagagctttagtgcaccgg |
18741967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 19414541 - 19414585
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| | ||||||||||| |
|
|
| T |
19414541 |
gaccccttcccgtaccctgcatatgcgggagctctagtgcaccgg |
19414585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 20004144 - 20004100
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||| ||||| || |||||||||| ||||||||||||| |
|
|
| T |
20004144 |
gaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
20004100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 27201753 - 27201793
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgca |
48 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||| |
|
|
| T |
27201753 |
gaccccttcccggaccttgcgtatgcgggagctttagtgca |
27201793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 30555219 - 30555263
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||| |||||||||| |||||| ||| ||||||||||||| |
|
|
| T |
30555219 |
gaccccttcacggaccctgcgtatgcgagagctttagtgcaccgg |
30555263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 37; Significance: 0.000000000009; HSPs: 2)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 46912 - 46956
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
46912 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
46956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 24826 - 24786
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgca |
48 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| ||||||||| |
|
|
| T |
24826 |
gaccccttcccgaaccctgcgtatgcgggagctttagtgca |
24786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000009; HSPs: 13)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 29355909 - 29355865
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
29355909 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
29355865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 12221969 - 12221924
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggag-ttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
12221969 |
gaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgg |
12221924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 1347043 - 1347087
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
1347043 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
1347087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 1354811 - 1354767
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
1354811 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
1354767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 6808476 - 6808520
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
6808476 |
gaccccttcccggaccctgtgtatgcgggagctttagtgcaccgg |
6808520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 12892090 - 12892134
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
12892090 |
gaccccttcccggaccccgcatatgcgggagctttagtgcaccgg |
12892134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 14975144 - 14975100
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
14975144 |
gaccccttcccgaaccccgcatatgcgggagttttagtgcaccgg |
14975100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 26097239 - 26097283
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
26097239 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
26097283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 8 - 51
Target Start/End: Complemental strand, 23930181 - 23930138
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccg |
51 |
Q |
| |
|
||||||||| |||||||||| |||||||||| |||||||||||| |
|
|
| T |
23930181 |
gaccccttcacggaccctgcttatgcgggagctttagtgcaccg |
23930138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 25557805 - 25557848
Alignment:
| Q |
9 |
accccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
25557805 |
accccttcccggaccctgcatatgcgggagctctagtgcaccgg |
25557848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 10734957 - 10734915
Alignment:
| Q |
10 |
ccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||| |||||| |
|
|
| T |
10734957 |
ccccttcccggaccctgcgtatgcgggagctttagtccaccgg |
10734915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 11395842 - 11395886
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||| ||||| |||||||||| |||||| |||||| |
|
|
| T |
11395842 |
gaccccttcccggatcctgcgtatgcgggagctttagtccaccgg |
11395886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 12885994 - 12886038
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||| |||||||| |||| ||||| ||||||||||||| |
|
|
| T |
12885994 |
gaccccttcccagaccctgcgtatgtgggagctttagtgcaccgg |
12886038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000009; HSPs: 36)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 20639712 - 20639668
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
20639712 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
20639668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 23501870 - 23501914
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
23501870 |
gaccccttcccggaccctgcatatgcgggagctttagtgcaccgg |
23501914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 32484314 - 32484358
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
32484314 |
gaccccttcccggaccctgcatatgcgggagctttagtgcaccgg |
32484358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 38755962 - 38755918
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
38755962 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
38755918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 40553991 - 40553947
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
40553991 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
40553947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 44363184 - 44363140
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
44363184 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
44363140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 6 - 49
Target Start/End: Original strand, 30639458 - 30639501
Alignment:
| Q |
6 |
gagaccccttcccggaccctgcctatgcgggagttttagtgcac |
49 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
30639458 |
gagaccccttcccggaccctgcatatgcgggagctttagtgcac |
30639501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 9 - 52
Target Start/End: Complemental strand, 50555709 - 50555666
Alignment:
| Q |
9 |
accccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
50555709 |
accccttcccggaccctgcgtatgcaggagttttagtgcaccgg |
50555666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 8 - 50
Target Start/End: Complemental strand, 30690230 - 30690188
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcacc |
50 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
30690230 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcacc |
30690188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 9 - 51
Target Start/End: Original strand, 54730334 - 54730376
Alignment:
| Q |
9 |
accccttcccggaccctgcctatgcgggagttttagtgcaccg |
51 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
54730334 |
accccttcccggaccctgcgtatgcgggagctttagtgcaccg |
54730376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 10 - 55
Target Start/End: Complemental strand, 51865090 - 51865045
Alignment:
| Q |
10 |
ccccttcccggaccctgcctatgcgggagttttagtgcaccggact |
55 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||| ||||||||||| |
|
|
| T |
51865090 |
ccccttcccggaccctgcgtatgcgggagctttattgcaccggact |
51865045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 11394933 - 11394977
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||| ||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
11394933 |
gacccctttccggaccctgcgtatgcgggagctttagtgcaccgg |
11394977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 11404660 - 11404704
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||| ||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
11404660 |
gacccctttccggaccctgcgtatgcgggagctttagtgcaccgg |
11404704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 20225063 - 20225107
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
20225063 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
20225107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 20225157 - 20225201
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
20225157 |
gaccccttcccggaccccgcatatgcgggagctttagtgcaccgg |
20225201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 25629130 - 25629174
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
25629130 |
gaccccttcccggaccctacatatgcgggagctttagtgcaccgg |
25629174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 29207952 - 29207908
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
29207952 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
29207908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 33836541 - 33836501
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgca |
48 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
33836541 |
gaccccttcccggaccctgcgtatgcgggagctttagtgca |
33836501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 35532077 - 35532117
Alignment:
| Q |
12 |
ccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35532077 |
ccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
35532117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 38786690 - 38786734
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
38786690 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
38786734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 9 - 52
Target Start/End: Complemental strand, 11054201 - 11054158
Alignment:
| Q |
9 |
accccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
11054201 |
accccttcccggaccctgcatatgcgggagctctagtgcaccgg |
11054158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 9 - 52
Target Start/End: Complemental strand, 16408654 - 16408611
Alignment:
| Q |
9 |
accccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
16408654 |
accccttcccggaccccgcatatgcgggagctttagtgcaccgg |
16408611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 8 - 51
Target Start/End: Complemental strand, 30352634 - 30352591
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccg |
51 |
Q |
| |
|
||||||||| |||||||||| |||||||||| |||||||||||| |
|
|
| T |
30352634 |
gaccccttctcggaccctgcgtatgcgggagctttagtgcaccg |
30352591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 8 - 46
Target Start/End: Original strand, 14983915 - 14983953
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtg |
46 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
14983915 |
gaccccttcccggaccctgcgtatgcgggagctttagtg |
14983953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 11 - 53
Target Start/End: Original strand, 40915912 - 40915954
Alignment:
| Q |
11 |
cccttcccggaccctgcctatgcgggagttttagtgcaccgga |
53 |
Q |
| |
|
||||||||||||||||| |||||||||| || ||||||||||| |
|
|
| T |
40915912 |
cccttcccggaccctgcgtatgcgggagcttcagtgcaccgga |
40915954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 5648339 - 5648380
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcac |
49 |
Q |
| |
|
|||||||||||||||||||| |||||||||| || ||||||| |
|
|
| T |
5648339 |
gaccccttcccggaccctgcgtatgcgggagcttcagtgcac |
5648380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 49
Target Start/End: Complemental strand, 20908690 - 20908649
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcac |
49 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
20908690 |
gaccccttcccgaaccctgcgtatgcgggagctttagtgcac |
20908649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 54175145 - 54175190
Alignment:
| Q |
8 |
gaccccttccc-ggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
54175145 |
gaccccttccccggaccctgcatatgcgggagctttagtgcaccgg |
54175190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 6430680 - 6430636
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||| ||||||||||||||| |||||||||| ||||| ||||||| |
|
|
| T |
6430680 |
gaccacttcccggaccctgcgtatgcgggagctttagcgcaccgg |
6430636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 8820589 - 8820629
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgca |
48 |
Q |
| |
|
||||||||||| |||||||| |||||| ||||||||||||| |
|
|
| T |
8820589 |
gaccccttcccagaccctgcgtatgcgagagttttagtgca |
8820629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 9 - 53
Target Start/End: Complemental strand, 10277810 - 10277766
Alignment:
| Q |
9 |
accccttcccggaccctgcctatgcgggagttttagtgcaccgga |
53 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| ||||| |||||| |
|
|
| T |
10277810 |
accccttcccagaccctgcatatgcgggagttctagtgaaccgga |
10277766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 20405170 - 20405210
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgca |
48 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||||| |
|
|
| T |
20405170 |
gaccccttcccggaccccgcatatgcgggagctttagtgca |
20405210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 21647047 - 21647091
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||| ||||| || |||||||||| ||||||||||||| |
|
|
| T |
21647047 |
gaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
21647091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 25388257 - 25388301
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| ||||||||||||| |
|
|
| T |
25388257 |
gaccccttcccggaccctgcgtatgcatgagctttagtgcaccgg |
25388301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 35567251 - 35567295
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||| ||||||| | |||||||| ||||||||||||| |
|
|
| T |
35567251 |
gaccccttcccgaaccctgcgtctgcgggagctttagtgcaccgg |
35567295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 47482904 - 47482864
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgca |
48 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||| ||||| |
|
|
| T |
47482904 |
gaccccttcccggaccctgcgtatgcgggagctttggtgca |
47482864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000009; HSPs: 28)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 13628844 - 13628800
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
13628844 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
13628800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 40272866 - 40272822
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
40272866 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
40272822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 54484794 - 54484838
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
54484794 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
54484838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 353403 - 353359
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
353403 |
gaccccttcccggaccccgcatatgcgggagctttagtgcaccgg |
353359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 516515 - 516559
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||| |
|
|
| T |
516515 |
gaccccttccccgaccctgcgtatgcgggagctttagtgcaccgg |
516559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 1217191 - 1217235
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
1217191 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
1217235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 10484670 - 10484626
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
10484670 |
gaccccttcctggaccctgcgtatgcgggagctttagtgcaccgg |
10484626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 13730656 - 13730612
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
13730656 |
gaccccttcccggaccccgcatatgcgggagctttagtgcaccgg |
13730612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 24851355 - 24851311
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||| ||||| |||||||||| ||||||||||||| |
|
|
| T |
24851355 |
gaccccttcccggatcctgcatatgcgggagctttagtgcaccgg |
24851311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 30452898 - 30452942
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
30452898 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
30452942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 34771418 - 34771374
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
34771418 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
34771374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 39203617 - 39203661
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
39203617 |
gaccccttcccggaccttgcatatgcgggagctttagtgcaccgg |
39203661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 45948892 - 45948848
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||| |||||||||| |||||||||| ||||||||||||| |
|
|
| T |
45948892 |
gaccccttctcggaccctgcgtatgcgggagctttagtgcaccgg |
45948848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 5173771 - 5173729
Alignment:
| Q |
10 |
ccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
5173771 |
ccccttcccggaccttgcgtatgcgggagctttagtgcaccgg |
5173729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 14 - 52
Target Start/End: Original strand, 47624208 - 47624246
Alignment:
| Q |
14 |
ttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
47624208 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgg |
47624246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 8 - 50
Target Start/End: Complemental strand, 54374399 - 54374357
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcacc |
50 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||| |||| |
|
|
| T |
54374399 |
gaccccttcccggaccctgcatatgcgggagctttagttcacc |
54374357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 49
Target Start/End: Complemental strand, 29366774 - 29366733
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcac |
49 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| |||||||||| |
|
|
| T |
29366774 |
gaccccttcccggaccctgcgtatgtgggagctttagtgcac |
29366733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 46421089 - 46421044
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggag-ttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||| |||||||||| |
|
|
| T |
46421089 |
gaccccttcccggaccctgcgtatgcgggagctttaagtgcaccgg |
46421044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 829496 - 829452
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||| ||||||| ||||| |||| ||||||||||||| |
|
|
| T |
829496 |
gaccccttcccgaaccctgcgtatgcaggagctttagtgcaccgg |
829452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 14987062 - 14987106
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||| |||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
14987062 |
gacccattcccggaccttgcatatgcgggagctttagtgcaccgg |
14987106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 15797323 - 15797367
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| | ||||||||||| |
|
|
| T |
15797323 |
gaccccttcccggaccctgcatatgtgggagctctagtgcaccgg |
15797367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 22122971 - 22122927
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||| ||| | ||||||||||| |
|
|
| T |
22122971 |
gaccccttcccggaccctgcatatgcgagagctctagtgcaccgg |
22122927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 22609868 - 22609912
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| || |||||||||| |
|
|
| T |
22609868 |
gaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgg |
22609912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 25517224 - 25517180
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||| ||||||||||||| |
|
|
| T |
25517224 |
gaccccttcccggatcctgcgtatgctggagctttagtgcaccgg |
25517180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 31592954 - 31592994
Alignment:
| Q |
12 |
ccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
31592954 |
ccttcccggaccctgcatatgcgggagctctagtgcaccgg |
31592994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 45786268 - 45786224
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
45786268 |
gaccccttcccggaccctgcgaatgctggagctttagtgcaccgg |
45786224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 49013527 - 49013483
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||| || || ||||||| ||||||||||||| |
|
|
| T |
49013527 |
gaccccttcccggaccccgcatacgcgggagctttagtgcaccgg |
49013483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 12 - 52
Target Start/End: Complemental strand, 52926269 - 52926229
Alignment:
| Q |
12 |
ccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||| ||||||| |
|
|
| T |
52926269 |
ccttcccggaccctgcgtatgcgggagctttagcgcaccgg |
52926229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 18)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 21566517 - 21566567
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccggactacc |
58 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| ||||||||||||| ||||| |
|
|
| T |
21566517 |
gaccccttcccgaaccctgcatatgcgggagctttagtgcaccgggctacc |
21566567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 9 - 50
Target Start/End: Complemental strand, 45018976 - 45018935
Alignment:
| Q |
9 |
accccttcccggaccctgcctatgcgggagttttagtgcacc |
50 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
45018976 |
accccttcccggaccctgcgtatgcgggagctttagtgcacc |
45018935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 2541073 - 2541029
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||| |||||| |||||||||| ||||||||||||| |
|
|
| T |
2541073 |
gaccccttcccggtccctgcgtatgcgggagctttagtgcaccgg |
2541029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 7879719 - 7879763
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| || |||||||||| |
|
|
| T |
7879719 |
gaccccttcccggaccctgcgtatgcgggagcttcagtgcaccgg |
7879763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 21172063 - 21172019
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
21172063 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
21172019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 32758340 - 32758384
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
32758340 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
32758384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 35334870 - 35334826
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
35334870 |
gaccccttcccggaccctgcgtatgcaggagctttagtgcaccgg |
35334826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 42391154 - 42391110
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
42391154 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
42391110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 42805607 - 42805651
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
42805607 |
gaccccttcccggaccccgcatatgcgggagctttagtgcaccgg |
42805651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 48735176 - 48735132
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
48735176 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
48735132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 11 - 50
Target Start/End: Complemental strand, 42495913 - 42495874
Alignment:
| Q |
11 |
cccttcccggaccctgcctatgcgggagttttagtgcacc |
50 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
42495913 |
cccttcccggaccctgcgtatgcgggagctttagtgcacc |
42495874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 49
Target Start/End: Complemental strand, 10693127 - 10693086
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcac |
49 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | |||||||| |
|
|
| T |
10693127 |
gaccccttcccggaccctgcatatgcgggagctctagtgcac |
10693086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 49
Target Start/End: Complemental strand, 18512507 - 18512466
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcac |
49 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||| |||||| |
|
|
| T |
18512507 |
gaccccttcccggaccctgcgtatgcgggagctttggtgcac |
18512466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 53
Target Start/End: Complemental strand, 38262250 - 38262205
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgga |
53 |
Q |
| |
|
|||||||||||| || |||| |||||||||| |||||||||||||| |
|
|
| T |
38262250 |
gaccccttcccgaacactgcgtatgcgggagctttagtgcaccgga |
38262205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 18747568 - 18747612
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||| | ||||||| |||||||||| ||||||||||||| |
|
|
| T |
18747568 |
gaccccttcctgaaccctgcgtatgcgggagctttagtgcaccgg |
18747612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 27889370 - 27889326
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||| || |||||| |
|
|
| T |
27889370 |
gaccccttcccggaccctgcgtatgcgggagctttggtacaccgg |
27889326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 31591163 - 31591119
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| | ||||||||||| |
|
|
| T |
31591163 |
gaccccttcccggaccttgcatatgcgggagctctagtgcaccgg |
31591119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 47716542 - 47716586
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||| ||||||||| |
|
|
| T |
47716542 |
gaccccttcccggaccccgcatatgcgggagctttggtgcaccgg |
47716586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 10891 - 10932
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcac |
49 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
10891 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcac |
10932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 8 - 53
Target Start/End: Complemental strand, 24187 - 24142
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgga |
53 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | |||||||||||| |
|
|
| T |
24187 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgga |
24142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 30658 - 30702
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
30658 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
30702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 48688 - 48644
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
48688 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
48644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 8 - 50
Target Start/End: Complemental strand, 1641 - 1599
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcacc |
50 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||||||| |
|
|
| T |
1641 |
gaccccttcccggacccggcgtatgcgggagctttagtgcacc |
1599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 9 - 50
Target Start/End: Complemental strand, 72920 - 72879
Alignment:
| Q |
9 |
accccttcccggaccctgcctatgcgggagttttagtgcacc |
50 |
Q |
| |
|
||||||||||||| ||||| |||||||||| ||||||||||| |
|
|
| T |
72920 |
accccttcccggaacctgcgtatgcgggagctttagtgcacc |
72879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 13078 - 13034
Alignment:
| Q |
8 |
gaccccttcccggaccctgcctatgcgggagttttagtgcaccgg |
52 |
Q |
| |
|
||||||||||| |||||||| |||||||| | ||||||||||||| |
|
|
| T |
13078 |
gaccccttcccagaccctgcgtatgcgggggctttagtgcaccgg |
13034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University