View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7257_high_23 (Length: 301)
Name: NF7257_high_23
Description: NF7257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7257_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 19 - 290
Target Start/End: Complemental strand, 50552574 - 50552303
Alignment:
| Q |
19 |
acttgtactctactatctatgtcaaacttataaagtatttgacaaaattttatatataccttttgttattttgaaatttaacccctctctccctcctctc |
118 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50552574 |
acttgtagtctactatctatgtcaaacttataaagtatttgacaaaattttacatataccttttgttattttgaaatttaacccctctctccctactctc |
50552475 |
T |
 |
| Q |
119 |
taacaattgtcatattataagtaaaatatgttagccaataaattatatctcgtggataatttttattggtctcacatcatgtgggtaaattatacacaat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50552474 |
taacaattgtcatattataagtaaaatatgttagccaataaatcatctctcgtggataatttttattggtctcacatcatgtgggtaaattatacacaat |
50552375 |
T |
 |
| Q |
219 |
tattcaaatgtaacttaggttgataatgttgtaagttctaaaacttatataaattgattgattggtatctct |
290 |
Q |
| |
|
| || ||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
50552374 |
tctttaaatgtaacttaggttgataatgttctaagttctaaaactaatataaattgattgattggtatctct |
50552303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University