View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7257_high_31 (Length: 222)
Name: NF7257_high_31
Description: NF7257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7257_high_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 19 - 211
Target Start/End: Original strand, 41223022 - 41223208
Alignment:
| Q |
19 |
aatgtgtgtggaaagttgtggtgccgaatgaatatagttccgaagacatagaatcgaaaaattctattgaattgaattgaactcctttttaatgtgaatc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41223022 |
aatgtgtgtggaaagttgtggtgccgaatgaatatagttccgaagacatagaatcaaaaaattctattg-----aattgaactcctttttaatgtgaatc |
41223116 |
T |
 |
| Q |
119 |
aatatcctgcctctgcgcacgactgcagagactaattactcgaaccggataggatcacaaagggatcaaatctctccctctgagtatattctt |
211 |
Q |
| |
|
| ||||| |||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
41223117 |
agtatccagcctttgcgcacgactgcagagactaattcctcgaaccggataggatcacaaa-ggatcaaatctctccctctgagtattttctt |
41223208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University