View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7257_low_14 (Length: 391)
Name: NF7257_low_14
Description: NF7257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7257_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 3e-73; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 207 - 346
Target Start/End: Complemental strand, 26452973 - 26452834
Alignment:
| Q |
207 |
aggattggagagagtaaatattagtgaacttgcatcaaaatttagcagattttttcttgaaaaaacacacatggagacagttgatttgtgtgatatatgc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26452973 |
aggattggagagagtaaatattagtgaacttgcatcaaaatttagcagattttttcttgaaaaaacacacatggagacagttgatttgtgtgatatatgc |
26452874 |
T |
 |
| Q |
307 |
ttactgcattgcatcgaatgatagcagactttttctttga |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26452873 |
ttactgcattgcatcgaatgatagcagactttttctttga |
26452834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 51 - 210
Target Start/End: Complemental strand, 26453425 - 26453245
Alignment:
| Q |
51 |
atttagattgaattttatgtttgatattcttattgttttaatgactttcttaataatctttt---------------------attccttaacatatttc |
129 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26453425 |
attttgattgaattttatgtttgatattcttattgttttaatggctttcttaataatcttttgcgctttccatttttttttttattccttaacatatttc |
26453326 |
T |
 |
| Q |
130 |
aatgtttgatcttggcgaggtgaaggaatatgattggaattactgatcaagaagaagtctcaatattttcttcgatgagga |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26453325 |
aatgtttgatcttggtgaggtgaaggaatatgattggaattactgatcaagaagaagtctcaatattttcttcgatgagga |
26453245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 6 - 56
Target Start/End: Complemental strand, 26453567 - 26453517
Alignment:
| Q |
6 |
tgttgaagaagacaatgttgtttgttttagcctctcttcaatgccatttag |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26453567 |
tgttgaagaagacaatgttgtttgttttagcctctcttcaatgccatttag |
26453517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University