View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7257_low_22 (Length: 322)
Name: NF7257_low_22
Description: NF7257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7257_low_22 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 138 - 322
Target Start/End: Original strand, 45944453 - 45944638
Alignment:
| Q |
138 |
attagagtcactttatatcatcatcaaattgattttatcagtatagaagttgatttcttcaaccttttaatcaaagaatttgagaatagaaaatgagagg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45944453 |
attagagtcactttatatcatcatcaaattgatcttatcagtatagaagttgatttcttcaaccttttagtcaaagaatttgagaatagaaaatgagagg |
45944552 |
T |
 |
| Q |
238 |
agcaa-annnnnnnnnnnnnnattattaggtagttatgtagcgtctctttgaatctcttttgatgttatgagtcattttatgtgat |
322 |
Q |
| |
|
| ||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45944553 |
aacaatttttttttattttttattataaggtagttatgtagcgtctctttgaatctcttttgatgttatgagtcattttatgtgat |
45944638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University