View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7257_low_22 (Length: 322)

Name: NF7257_low_22
Description: NF7257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7257_low_22
NF7257_low_22
[»] chr1 (1 HSPs)
chr1 (138-322)||(45944453-45944638)


Alignment Details
Target: chr1 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 138 - 322
Target Start/End: Original strand, 45944453 - 45944638
Alignment:
138 attagagtcactttatatcatcatcaaattgattttatcagtatagaagttgatttcttcaaccttttaatcaaagaatttgagaatagaaaatgagagg 237  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
45944453 attagagtcactttatatcatcatcaaattgatcttatcagtatagaagttgatttcttcaaccttttagtcaaagaatttgagaatagaaaatgagagg 45944552  T
238 agcaa-annnnnnnnnnnnnnattattaggtagttatgtagcgtctctttgaatctcttttgatgttatgagtcattttatgtgat 322  Q
    | |||                ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45944553 aacaatttttttttattttttattataaggtagttatgtagcgtctctttgaatctcttttgatgttatgagtcattttatgtgat 45944638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University