View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7258_high_17 (Length: 246)
Name: NF7258_high_17
Description: NF7258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7258_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 20 - 229
Target Start/End: Complemental strand, 32555208 - 32555004
Alignment:
| Q |
20 |
ctggtgtcagagtggcagaactaccagcaccagctactagttgttgattctcaggattaagtgcctgaaaa-taaattagtattgttatcttcagattca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||||| |
|
|
| T |
32555208 |
ctggtgtcagagtggcagaactaccagcaccagctactagttgttgattctcaggattaagtgcctgaaaaataaattagtattcttatcttcggattca |
32555109 |
T |
 |
| Q |
119 |
gattctggaaagggaaatacaaaaagagccatccatatgaagtaggacatttctgataataataataatactcttttatcaacaaattttattggaaaaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| ||||| | |||||||||||||||||| |
|
|
| T |
32555108 |
gattctggaaagggaaatacaaaaagaaccatccatatgaagtaggacatttctgataat------aatactgttttactatcaaattttattggaaaaa |
32555015 |
T |
 |
| Q |
219 |
agttgtgattc |
229 |
Q |
| |
|
||||||||||| |
|
|
| T |
32555014 |
agttgtgattc |
32555004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University