View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7258_low_11 (Length: 280)
Name: NF7258_low_11
Description: NF7258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7258_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 267
Target Start/End: Complemental strand, 45846732 - 45846482
Alignment:
| Q |
17 |
caaatgcaattcaaaatctgaatatctagtagtttcaatcaaagacacaaaagagtcnnnnnnnnnnnnnnnnntgatgaccaatccacttatccaaaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45846732 |
caaatgcaattcaaaatctgaatatctagtagtttcaatcaaagacacaaaagagtccaacaacaacaacaacatgatgaccaatccacttatccaaaaa |
45846633 |
T |
|
| Q |
117 |
gacataaacatagaaaatccaacaacacaattccaaaaaacccatcttagagctaccttcaaagaaattatttctatatccaaaattgcttttcccatga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45846632 |
gacataaacatagaaaatccaacaacacaattccaaaaaacccatcttagagctaccttcaaagaagttatttctatatccaaaattgcttttcccatga |
45846533 |
T |
|
| Q |
217 |
ttttcaccggtctcttactctattgtcgttcaatgatctccatgctctttc |
267 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45846532 |
ttttcaccggtcttttactctattgtcgttcaatgatctccatgctctttc |
45846482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University