View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7258_low_19 (Length: 239)
Name: NF7258_low_19
Description: NF7258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7258_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 20 - 233
Target Start/End: Original strand, 39988266 - 39988479
Alignment:
| Q |
20 |
tagctgtctaatgccatttcgtggtgatatacttgattgatccaacttggctttggggatacaagatggagagtacaacttgggctcttcgctcacaacc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39988266 |
tagctgtctaatgccatttcgtggtgatatacttgattgatccaacttggctttggggatacaagatggagagtacaacttgggctcttcgctcacaacc |
39988365 |
T |
|
| Q |
120 |
aattgcttccactcttctgtaatataggccatggttctgtcatcttggtccgtaatatccatggacaaagttccctcatccacaccaatgacattagttg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39988366 |
aattgcttccactcttctgtaatataggccatggttctgtcatcttggtccgtaatatccatggacaaagttccctcatccacaccaatgacattagttg |
39988465 |
T |
|
| Q |
220 |
ctgattcttctctc |
233 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
39988466 |
ctgattctgctctc |
39988479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University