View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7258_low_21 (Length: 219)
Name: NF7258_low_21
Description: NF7258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7258_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 14 - 179
Target Start/End: Complemental strand, 10029747 - 10029577
Alignment:
| Q |
14 |
aagaagaagaaaaggaaaaccatggaagtcgtgttccttccaattcggcgaatccaggcttaattttaagggaattgaagcaagcgaaattgaatctaaa |
113 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10029747 |
aagaagaagaaaaggaaaaccatgggagtcgtgttccttccaattcggcgagtccaggcttaattttaagggaattgaagcaagcgaaattgaatctaaa |
10029648 |
T |
|
| Q |
114 |
ccgagcaacaaacaatatcgctgatgttcgag-----gtggaatcactcaaaaagaaacttcagaaggaaa |
179 |
Q |
| |
|
|||| |||| || |||| ||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
10029647 |
ccgaacaacgaatgatattgctgatgttcgagtttctgtggaatcactcaacaagaaacttcagaaggaaa |
10029577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University