View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7260_low_3 (Length: 229)
Name: NF7260_low_3
Description: NF7260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7260_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 7 - 129
Target Start/End: Complemental strand, 40631496 - 40631374
Alignment:
| Q |
7 |
tctctaactagaaattgctccaatttcggtcctttgctatctccatagctctcatggcaccaatcagttaagccctcaaagaattaccaacgcccagacc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40631496 |
tctctaactagaaattgctccaatttcggtccttcgctatctccatagctctcatggcaccaatcagttaagcactcaaagaattaccaacgcccagacc |
40631397 |
T |
 |
| Q |
107 |
gttagcaaaatatcctccaaatt |
129 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
40631396 |
tttagcaaaacatcctccaaatt |
40631374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 135 - 229
Target Start/End: Complemental strand, 40630701 - 40630607
Alignment:
| Q |
135 |
tttaaatgtgatcggggaacaaactttgcactacataaccttggactaaaaaccaaaagttaccatctttttattcatccacattgatgatataa |
229 |
Q |
| |
|
||||||||||||| || |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40630701 |
tttaaatgtgatcaggaaacaaactttgcactatataaccttggactaaaaaccaaaagttaccatctttttattcatccacatcgatgatataa |
40630607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University