View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7261_low_2 (Length: 270)
Name: NF7261_low_2
Description: NF7261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7261_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 3 - 267
Target Start/End: Original strand, 26348407 - 26348671
Alignment:
| Q |
3 |
tcatcatgtggtccaattactctttctgcttctaacaaaatctctttctcaacttctggattttttgctaacaaccaaaagaaacttgtgagtgatgatg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26348407 |
tcatcatgtggtccaattactctttctgcttctaacaaaatctctttctcaacttctggattttttgctaataaccaaaagaaacttgtgagtgatgatg |
26348506 |
T |
 |
| Q |
103 |
ccacggtgtcgcgaccagccaataagaaacttatgactatgtctctaagaaacatgtcatcatgaattgtagtactcatgaatcttgacaacaaatcttt |
202 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26348507 |
ccacggtgtcgcgaccggccaataagaaacttatgactatgtctctaagaaacatgtcatcatgaattgtagtactcatgaatcttgacaacaaatcttt |
26348606 |
T |
 |
| Q |
203 |
gtgatgggaaaaacctaattttctcttttgatttataacaactttggctaacatattaatgatgt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26348607 |
gtgatgggaaaaacctaattttctcttttgatttataacaactttggctaacatattaatgatgt |
26348671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University