View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7262_high_4 (Length: 272)
Name: NF7262_high_4
Description: NF7262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7262_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 13 - 263
Target Start/End: Original strand, 43866981 - 43867231
Alignment:
| Q |
13 |
aatatccagcgcaacaggcttctcaagaagcaaatgcttcttattctgggccgcaagaacggcccacttaaggtgcaagcttgtaggaagtggcatatac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43866981 |
aatatccagcgcaacaggcttctcaagaagcaaatgcttcttattctgggccgcaagaacggcccacttaaggtgcaagcttgtaggaagtggcatatac |
43867080 |
T |
 |
| Q |
113 |
acagcgtccacatcagggtcttccagcagagcttcgtagttcccgtacaccttcgctgttagtgggtagccattggcggcggcgaaagcggcggctttgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43867081 |
acagcgtccacatcagggtcttccagcagagcttcgtagttcccgtacaccttcgctgttagtgggtagccattggcggcggcgaaagcggcggctttgt |
43867180 |
T |
 |
| Q |
213 |
tgtagttgcggctggcgacggcgcagatggtggcgtttggggacaagttga |
263 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43867181 |
cgtagttgcggctagcgacggcgcagatggtggcgtttggggataagttga |
43867231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University