View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7262_high_5 (Length: 255)
Name: NF7262_high_5
Description: NF7262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7262_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 22 - 249
Target Start/End: Complemental strand, 17772302 - 17772075
Alignment:
| Q |
22 |
aaagaggagtattactcaattccaaaccattatcacagcttgtttgctgctctggcatctcatgaaccgctgcaatcggttttgattcaggaccatctga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17772302 |
aaagaggagtattactcaattccaaaccattatcacagcttgtttgctgctctggcatctcatgaaccgctgcaatcggttttgattcaggaccatctga |
17772203 |
T |
 |
| Q |
122 |
gatacttctatcttcattctcatgtttcataccaacagaagccatgttcgtcactggctcattcaaaccatacttatcatcctcgatattatcatcaacc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17772202 |
gatacttctatcttcattctcatgtttcataccaacagaagccatgttcgtcactggctcattcaaaccatacttatcatcctcgatattatcatcaacc |
17772103 |
T |
 |
| Q |
222 |
gtgacagtattcggtgtgttcatctcag |
249 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
17772102 |
gtgacagtattcggtgtgttcatttcag |
17772075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University