View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7263_high_6 (Length: 355)
Name: NF7263_high_6
Description: NF7263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7263_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 18 - 342
Target Start/End: Original strand, 36844448 - 36844772
Alignment:
| Q |
18 |
atctaccgatgagagtgtagagattcagagacagttacagcgtttgcaggtttctgagagtgagcagtctctatatcggagaagttcggatggtgttaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36844448 |
atctaccgatgagagtgtagagattcagagacagttacagcgtttgcaggtttctgagagtgagcagtctctatatcggagaagttcggatggtgttaca |
36844547 |
T |
|
| Q |
118 |
ggtggttacgccgccgctcccggcggtgattattacgtgcagaagatgccggagaatattcctcggtctaattcgccagtaacagttcatcatcctgcag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36844548 |
ggtggttacgccgccgctcccggcggtgattattacgtacagaagatgccggagaatattcctcggtctaattcgccagtaacagttcatcatcctgcag |
36844647 |
T |
|
| Q |
218 |
gttactggccggataaacaattttccggcgaagcttttccggtgacagggatgaacacttccggtggaggggatcagcatgtttacatgatgccgccgcc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36844648 |
gttactggccggataaacaattttccggcgaagcttttcctgtgacagggatgaacacttccggtggaggggatcagcatgtttacatgatgccgccgcc |
36844747 |
T |
|
| Q |
318 |
gggaacattctatcagacagcacag |
342 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
36844748 |
gggaacattctatcagacagcacag |
36844772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University