View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7263_high_8 (Length: 248)
Name: NF7263_high_8
Description: NF7263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7263_high_8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 53 - 248
Target Start/End: Complemental strand, 10300203 - 10300008
Alignment:
| Q |
53 |
aacttggattacatagatattagttagagctttgagtcttcattttgaagcttaactataatttggttttgtcataaaaagatgacagtggaaaaaggta |
152 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10300203 |
aacttggattacatagatattagttagagttttgagtcttcattttgaagcttaactataatttggttttgtcataaaaagatgacagtggaaaaaggta |
10300104 |
T |
 |
| Q |
153 |
gcaacatgaaccatcaacaacagccatttgaagtatccattgacactgctggttccaagtgttttgacgacgatggccgtttaaaacgaactggta |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10300103 |
gcaacatgaaccatcaacaacagccatttgaagtatccattgacactgctggttccaagtgttttgacgacgatggccgtttaaaacgaactggta |
10300008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University