View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7263_high_9 (Length: 240)
Name: NF7263_high_9
Description: NF7263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7263_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 10299972 - 10299750
Alignment:
| Q |
1 |
tttaaaacatacagtaaaggttctcgtgagtttgactcagttggtagggacatacagtaaaaaggtgaaaacctctgatgtattctctcttctcttgtgt |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||| | ||||||||| |||| ||||||||| || | ||||||||| ||||||||||| |
|
|
| T |
10299972 |
tttaaaacatacagtaaaagttctcgtgagtttagttcagttggtaagtacatacagtcaaaacgtgaaaaccactaacgtattctcttttctcttgtgt |
10299873 |
T |
 |
| Q |
101 |
gtgacataaataggaaatgaatggacagcaagtgcacacataatcacagctgtgattggttctggagtgctgtctttggcatgggctattgcacaacttg |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10299872 |
gtgacataaacaggaaatgaatggacagcaagtgcacacataatcacagctgtgattggttctggagtgctgtctttggcatgggctattgcacaacttg |
10299773 |
T |
 |
| Q |
201 |
gatggattgctggaccatcaatg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10299772 |
gatggattgctggaccatcaatg |
10299750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 131 - 210
Target Start/End: Complemental strand, 47919911 - 47919832
Alignment:
| Q |
131 |
agtgcacacataatcacagctgtgattggttctggagtgctgtctttggcatgggctattgcacaacttggatggattgc |
210 |
Q |
| |
|
|||||||||||| | || |||||||| || ||||||||| |||| |||||||||||| |||||||| | || |||||||| |
|
|
| T |
47919911 |
agtgcacacatagtgactgctgtgataggatctggagtgttgtcattggcatgggctgttgcacaattgggctggattgc |
47919832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 47911100 - 47911018
Alignment:
| Q |
128 |
gcaagtgcacacataatcacagctgtgattggttctggagtgctgtctttggcatgggctattgcacaacttggatggattgc |
210 |
Q |
| |
|
||||||||||||||| | || ||||| || || ||||||||| |||| |||||||||||| |||||||| | || |||||||| |
|
|
| T |
47911100 |
gcaagtgcacacatagtgactgctgtaataggatctggagtgttgtcattggcatgggctgttgcacaattgggttggattgc |
47911018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 52
Target Start/End: Original strand, 14768800 - 14768832
Alignment:
| Q |
20 |
gttctcgtgagtttgactcagttggtagggaca |
52 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
14768800 |
gttctcgtgagcttgactcagttggtagggaca |
14768832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 6e-21; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 122 - 213
Target Start/End: Original strand, 40203594 - 40203685
Alignment:
| Q |
122 |
tggacagcaagtgcacacataatcacagctgtgattggttctggagtgctgtctttggcatgggctattgcacaacttggatggattgctgg |
213 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||| || ||||||||||||||| | || ||||||||||| |||||||||||||||||||| |
|
|
| T |
40203594 |
tggactgcaagtgcacatgtaataacagctgtgatagggtctggagtgctgtctctagcttgggctattgctcaacttggatggattgctgg |
40203685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 122 - 213
Target Start/End: Original strand, 40199431 - 40199522
Alignment:
| Q |
122 |
tggacagcaagtgcacacataatcacagctgtgattggttctggagtgctgtctttggcatgggctattgcacaacttggatggattgctgg |
213 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||| | || ||||||||||||||| | | ||||||||||| |||||||||||||||||||| |
|
|
| T |
40199431 |
tggactgcaagtgcacatgtaataacagctgtggtagggtctggagtgctgtctctatcttgggctattgctcaacttggatggattgctgg |
40199522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 122 - 213
Target Start/End: Original strand, 40207750 - 40207841
Alignment:
| Q |
122 |
tggacagcaagtgcacacataatcacagctgtgattggttctggagtgctgtctttggcatgggctattgcacaacttggatggattgctgg |
213 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||| | || |||||||| |||||| | || ||||||||||| ||||| |||||||||||||| |
|
|
| T |
40207750 |
tggactgcaagtgcacatgtaataacagctgtggtagggtctggagttctgtctctagcttgggctattgctcaactcggatggattgctgg |
40207841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 209
Target Start/End: Complemental strand, 44307354 - 44307285
Alignment:
| Q |
140 |
ataatcacagctgtgattggttctggagtgctgtctttggcatgggctattgcacaacttggatggattg |
209 |
Q |
| |
|
||||| |||||||||||||| ||||| ||||| || || |||||||||| ||||||| | || ||||||| |
|
|
| T |
44307354 |
ataataacagctgtgattgggtctggggtgctatccttagcatgggctactgcacaattgggttggattg |
44307285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 20 - 53
Target Start/End: Complemental strand, 17499163 - 17499130
Alignment:
| Q |
20 |
gttctcgtgagtttgactcagttggtagggacat |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
17499163 |
gttctcgtgagtttgactcagttggtagggacat |
17499130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 218
Target Start/End: Original strand, 42369771 - 42369868
Alignment:
| Q |
121 |
atggacagcaagtgcacacataatcacagctgtgattggttctggagtgctgtctttggcatgggctattgcacaacttggatggattgctggaccat |
218 |
Q |
| |
|
|||||||||| ||||||||| | |||| ||||| || || |||||| | |||||| ||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
42369771 |
atggacagcagtagcacacatagtgacaggggtgataggatcaggagtgttatctttgccatggagcattgcacaacttggatggattgttggaccat |
42369868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University