View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7266_high_3 (Length: 281)
Name: NF7266_high_3
Description: NF7266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7266_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 9 - 266
Target Start/End: Complemental strand, 40446914 - 40446657
Alignment:
| Q |
9 |
tggtgtttggcagatggagaatgaattgaacatgagcatccagaaactggcnnnnnnnctgagagttggactggtgcaattgaattagattgttgtgtgt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40446914 |
tggtgtttggcagatggagaatgaattgaacatgagcatccagcaactggcaaaaaaactgagagttggactagtgcaattgaattagattgttgtgtgt |
40446815 |
T |
 |
| Q |
109 |
gtaagatgagatcatgaattcagtgataagttgcgacgtgggaagaggaaatcatgtacacgcagtgaacttggttggaccagttcatgccttgaggagg |
208 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40446814 |
gtaagatgagattatgaattcagtgataagttgcgacgtgggaagaggaaatcatgtacacgcagtgaacttggttggaccagttcataccttgaggagg |
40446715 |
T |
 |
| Q |
209 |
agccgatcgatgcacattaatagccgcatattttattacacaatatggatgtagtaag |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40446714 |
agccgatcgatgcacattaatagccgcatactttattacacaatatggatgtagtaag |
40446657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University