View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7267_high_8 (Length: 209)
Name: NF7267_high_8
Description: NF7267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7267_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 20 - 192
Target Start/End: Original strand, 31967758 - 31967930
Alignment:
| Q |
20 |
aatggccccgcgcttcgccatatcagtcgacctagttccggcgacaatcgtaacggaggagaaattaaccatcacggaggcgaaacgagaagaggaaata |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
31967758 |
aatggccccgcgcttcgccatatcagtcgaccgagttccggcgacaatcgtaacggaggagaaattaaccatgacggtggcgaaacgagaagaggaaata |
31967857 |
T |
|
| Q |
120 |
agtacggtggagacagagaagcgttggaaagaaaatgaggagaaagagagatggaccggttggaaggaatatt |
192 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31967858 |
agtacggtggagacagagaagcgttgggaagagaatgaggagaaagagagacggaccggttggaaggaatatt |
31967930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 29 - 192
Target Start/End: Complemental strand, 49789747 - 49789584
Alignment:
| Q |
29 |
gcgcttcgccatatcagtcgacctagttccggcgacaatcgtaacggaggagaaattaaccatcacggaggcgaaacgagaagaggaaataagtacggtg |
128 |
Q |
| |
|
||||||||||||||| ||| ||| |||| ||||| ||||| |||| ||||||||| ||| | ||||| || ||||||||||| |||| |||||||||| |
|
|
| T |
49789747 |
gcgcttcgccatatccgtcaaccgagttgcggcgccaatcctaactgaggagaaaagaacaacgacggatgcaaaacgagaagaagaaagaagtacggtg |
49789648 |
T |
|
| Q |
129 |
gagacagagaagcgttggaaagaaaatgaggagaaagagagatggaccggttggaaggaatatt |
192 |
Q |
| |
|
| || ||||||||||||| | || || |||||||||||||| ||| |||| ||| |||||||| |
|
|
| T |
49789647 |
gtgatagagaagcgttgggatgagaagaaggagaaagagagacggagcggtcggagggaatatt |
49789584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University