View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7267_low_5 (Length: 407)
Name: NF7267_low_5
Description: NF7267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7267_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 173 - 365
Target Start/End: Original strand, 48057165 - 48057357
Alignment:
| Q |
173 |
ttatgatggcttggctggaaacaactaaagctatgtcttggcaattttagttccactgaagtttgaactaggctttcaagtgcaagtttgctacaaaatt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48057165 |
ttatgatggcttggctggaaacaactaaagctatgtcttggcaattttagtttcactgaagtttgaactaggctttcaagtgcaagtttgctacaaaatt |
48057264 |
T |
|
| Q |
273 |
gatgaaacaatatcatcctaatagttttcacattcatgcaatcatcgaggaaatattgaaagaaataaatcaacaaaacctacgtggcactta |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48057265 |
gatgaaacaatatcatcctaatagttttcacattgatgcaatcatcgaggaaatattgagagaaataaatcaacaaaacctacgtggcactta |
48057357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 48056995 - 48057119
Alignment:
| Q |
1 |
aacagatgatggagttcatttcttgagacaggtagattctcataatcagctgcatcaacaacgtaacacttagagttccggcnnnnnnngtggatgataa |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
48056995 |
aacaaatgatggagttcatttcttgagacaggtagattctcataatcacctgcatcaacaacgta--acttagagttccggcaaaaaaagtggatgataa |
48057092 |
T |
|
| Q |
101 |
ttgatctttatttgcttgggataatct |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
48057093 |
ttgatctttatttgcttgggataatct |
48057119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University