View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7268_low_4 (Length: 204)
Name: NF7268_low_4
Description: NF7268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7268_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 56 - 191
Target Start/End: Complemental strand, 41154616 - 41154481
Alignment:
| Q |
56 |
tcacacataactcttcccgaaaacgtgattgtggtcatttttcaaattaaattgaagatccaattgcattaatttatatgttggttttattgaagagatg |
155 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41154616 |
tcacacataactcttcccgaaaacgtgtttgtggtcatttttcaaattaaattgaagatccaattgcattaatttatatgttggttttattgaagagatg |
41154517 |
T |
|
| Q |
156 |
accgcgtaccgtgacatcttagatgttgaaaaaact |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41154516 |
accgcgtaccgtgacatcttagatgttgaaaaaact |
41154481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University