View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7276_high_7 (Length: 250)
Name: NF7276_high_7
Description: NF7276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7276_high_7 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 250
Target Start/End: Original strand, 32550582 - 32550813
Alignment:
| Q |
19 |
gcatgagcagtgttcttataactgggaagatgagaggctcgaccatcgttaactgcgaatcaagcaatgcttcnnnnnnnnttgaatagaaggtagggga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32550582 |
gcatgagcagtgttcttataactgggaagatgagaggctcgaccatcgttaactgcgaatcaagcaatgcttcaaaaaaaattgaatagaaggtagggga |
32550681 |
T |
 |
| Q |
119 |
aatatggaagnnnnnnnttgatcgatatgagaaagagtgagagaaccttgaaacctagttcggacaacgtcgaggggatgcatgacggcgacggtggcga |
218 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32550682 |
aatatggaagaaaaaaattgatcgatatgagaaagagtgagagaaccttgaaacctagttcggacaacgtcgaggggatgcatgacggcgacggtggcga |
32550781 |
T |
 |
| Q |
219 |
atccagcggcggcgccggcagtggcgttctcc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32550782 |
atccagcggcggcgccggcagtggcgttctcc |
32550813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University