View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7276_high_8 (Length: 250)
Name: NF7276_high_8
Description: NF7276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7276_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 41 - 199
Target Start/End: Complemental strand, 46645113 - 46644959
Alignment:
| Q |
41 |
tatgctatgctatgtttgtcatatataataacgtagatatactttcaatatttcgcgattaattgtttacactatttgctttgtaaagtagtacatgtgt |
140 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46645113 |
tatgctatgctatgtttgtcata----ataacgtagatatactttcaatatttcgcgattaattgtttacactatttgctttgtaaagtagtacatgtgt |
46645018 |
T |
|
| Q |
141 |
ttaatctttgttttgttcgtgcttctttcttatattttacattccattcgccggtacac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46645017 |
ttaatctttgttttgttcgtgcttctttcttatattttacattccattcgccggtacac |
46644959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University