View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7276_high_9 (Length: 217)
Name: NF7276_high_9
Description: NF7276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7276_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 99
Target Start/End: Original strand, 783485 - 783566
Alignment:
| Q |
18 |
taaggattcataatgcttgcttaattgggtatgtaatgcatgtacttatattatcacatttatttatgtgacaaatgctaaa |
99 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
783485 |
taaggattgataatgcttgcttaattgggtatgtaatgcatgtacttatattatcacatttatttatgtgacaaatgctaaa |
783566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 195
Target Start/End: Original strand, 783620 - 783656
Alignment:
| Q |
159 |
gaatgaatattaatccgctttagcttttattagtaat |
195 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
783620 |
gaatgaatattaatctgctttagcttttattagtaat |
783656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University