View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7276_low_11 (Length: 210)
Name: NF7276_low_11
Description: NF7276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7276_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 97 - 191
Target Start/End: Original strand, 14408428 - 14408522
Alignment:
| Q |
97 |
ttataatcgaaagatccaaagattgaattcnnnnnnncacataataaaagaatgaaactcgaaatacaaaccatcacgagcgttggagtagttaa |
191 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14408428 |
ttataatccaaagatccaaagattgaattaaaaaaaacacataataaaagaatgaaactcgaaatacaaaccatcacgagcgttggagtagttaa |
14408522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University