View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7276_low_12 (Length: 210)

Name: NF7276_low_12
Description: NF7276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7276_low_12
NF7276_low_12
[»] chr2 (1 HSPs)
chr2 (16-194)||(37511807-37511985)


Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 194
Target Start/End: Complemental strand, 37511985 - 37511807
Alignment:
16 agaaaattacgaagataatccttcttattctgctaaaggacagtgtgctatttgtttagtacgtatcggtcatcttgctcatattcattgtgttgtcaaa 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37511985 agaaaattacgaagataatccttcttattctgctaaaggacagtgtgctatttgtttagtacgtatcggtcatcttgctcatattcattgtgttgtcaaa 37511886  T
116 tgaaatactgaagatatttaatttgcaacacataaaatagaggtactgaattgaataatattttttgggtacacgtttt 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
37511885 tgaaatactgaagatatttaatttgcaacacataaaatagaggtactgaatcgaataatattttttgggtacacgtttt 37511807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University