View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7276_low_12 (Length: 210)
Name: NF7276_low_12
Description: NF7276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7276_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 194
Target Start/End: Complemental strand, 37511985 - 37511807
Alignment:
| Q |
16 |
agaaaattacgaagataatccttcttattctgctaaaggacagtgtgctatttgtttagtacgtatcggtcatcttgctcatattcattgtgttgtcaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37511985 |
agaaaattacgaagataatccttcttattctgctaaaggacagtgtgctatttgtttagtacgtatcggtcatcttgctcatattcattgtgttgtcaaa |
37511886 |
T |
|
| Q |
116 |
tgaaatactgaagatatttaatttgcaacacataaaatagaggtactgaattgaataatattttttgggtacacgtttt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37511885 |
tgaaatactgaagatatttaatttgcaacacataaaatagaggtactgaatcgaataatattttttgggtacacgtttt |
37511807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University