View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7278_high_1 (Length: 202)
Name: NF7278_high_1
Description: NF7278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7278_high_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 18 - 188
Target Start/End: Complemental strand, 26276274 - 26276105
Alignment:
| Q |
18 |
gttaccctctctattgatgattcccatgataggctgaattggagggcctccgttgatggaaaacttactagcaaaattgcgcctataacaccttgcgcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26276274 |
gttaccctctctattgatgattcccatgataggctgaattggagggcctctgttgatggaaaacttactagcaaaattgcgcctataacaccttgcgcat |
26276175 |
T |
|
| Q |
118 |
ctttggtcctaaggtgaggtggtgtaagttagtttggaacaatttcgtccctccctctaggtctttcattt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26276174 |
ctttggtcctaaggtgaggtggtgtaagttagtttggaacaatttcgtccct-cctctaggtctttcattt |
26276105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University