View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7280_high_16 (Length: 204)
Name: NF7280_high_16
Description: NF7280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7280_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 14 - 156
Target Start/End: Complemental strand, 42246247 - 42246105
Alignment:
| Q |
14 |
tgagaagaagggaagactgcttatgaaagttgatatggatgactacaaagaatatgactctaaccacaagaatgatcaagggaaagggaagccccacggt |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42246247 |
tgagatgaagggaagactgcttatgaaagttgatacggatgactacaaagaatatgactctaaccacaagaatgatcaagggaaagggaagccccacggt |
42246148 |
T |
|
| Q |
114 |
tggacttaacctaatgctagttgggttgctaataatatgttat |
156 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42246147 |
tgaacttaacctaatgctagttgggttgctaataatatgttat |
42246105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University