View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7280_low_9 (Length: 334)
Name: NF7280_low_9
Description: NF7280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7280_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 8 - 207
Target Start/End: Complemental strand, 43494898 - 43494694
Alignment:
| Q |
8 |
cgcaccttgaggaactaaaccccaaccaagagattcaatggataagcttgaaactaatctcgctgatgcgaccgcgctatagaacggcagcattgattcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43494898 |
cgcaccttgaggaactaaaccccaaccaagagattcaatggataagcttgaaactaatctcgctgatgcgaccgcgctatagaacggcagcattgattcc |
43494799 |
T |
 |
| Q |
108 |
aagctactcaactccaccggtaacctaatcaacaaaattgaagaaaaatgattcaaaat-----aattaaatttgagttataataaaatgaatgattagg |
202 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
43494798 |
aagctactcaactctaccggtaacctaatcaacaaaattgaagaaaaatgattcaaaataattgaattgaatttgagttataataaaatgaaagattagg |
43494699 |
T |
 |
| Q |
203 |
taggt |
207 |
Q |
| |
|
||||| |
|
|
| T |
43494698 |
taggt |
43494694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University