View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7281_high_7 (Length: 279)
Name: NF7281_high_7
Description: NF7281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7281_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 43222844 - 43222575
Alignment:
| Q |
1 |
gctatgagatcataaactatggttcctttaccttggtannnnnnnagctgctagcatgtg----tgaccaccatgtatgtgttttacgtttccaatgcca |
96 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43222844 |
gctatgagatcataaactattgttcctttaccttggtatttttttagctgctagcatgtgagaatgaccaccatgtatgtgttttacgtttccaatgcca |
43222745 |
T |
 |
| Q |
97 |
tcactggnnnnnnnnnnnnnnnnnnnnnnnngcttgtttgtaaaatgtttgcttctgattgtaggtaacatctatttctgataaaggcattcgattatcg |
196 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43222744 |
tcactggtttttattttttattttattttttggttgtttgtaaaatgtttgcttctgattgtaggtaacatctatttctgataaaggcattcgattatcg |
43222645 |
T |
 |
| Q |
197 |
gagaaatgaacgggcttgtgggaatgaggaaaatcaagtctcagtgttcgatctctggaatgaacgggcc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43222644 |
gagaaatgaacgggcttgtgggaatgaggaaaatcaagtctcagtgttcgatctctggaatgaacgggcc |
43222575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 244
Target Start/End: Complemental strand, 43222586 - 43222543
Alignment:
| Q |
201 |
aatgaacgggcttgtgggaatgaggaaaatcaagtctcagtgtt |
244 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||||| |
|
|
| T |
43222586 |
aatgaacgggcctgtgggaattaggaaaatcaggtctcagtgtt |
43222543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University